Mutagenetix > Incidental Mutations

Incidental Mutation 'R2024:Padi6'

220248

Institutional Source

Beutler Lab

Gene Symbol

Padi6

Ensembl Gene

ENSMUSG00000040935

Gene Name

peptidyl arginine deiminase, type VI

Synonyms

Padi5, Pad6, ePAD

MMRRC Submission

040033-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2024 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

140727355-140742643 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 140728968 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 572 (I572L)

Ref Sequence

ENSEMBL: ENSMUSP00000044044 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038749]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000038749
AA Change: I572L

PolyPhen 2 Score 0.778 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000044044
Gene: ENSMUSG00000040935
AA Change: I572L

Domain	Start	End	E-Value	Type
Pfam:PAD_N	1	112	5.6e-38	PFAM
Pfam:PAD_M	114	269	6e-53	PFAM
Pfam:PAD	280	679	4.7e-149	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125046

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 90.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. This protein may play a role in cytoskeletal reorganization in the egg and in early embryo development. [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit altered oocyte cytoplasmic structures that lead to a failure of zygotes to progress beyond the 2 cell stage and female infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arid2	A	G	15: 96,361,799	D280G	probably damaging	Het
Azi2	C	T	9: 118,049,322	R77*	probably null	Het
Chd8	T	C	14: 52,231,493	D556G	probably benign	Het
Cit	T	C	5: 115,947,924	M849T	probably damaging	Het
Cit	T	C	5: 116,005,840	S1923P	probably damaging	Het
Col17a1	T	A	19: 47,650,746	H1120L	probably benign	Het
Col6a5	G	T	9: 105,936,994	H606Q	unknown	Het
Dnajc2	A	C	5: 21,776,790	H45Q	probably damaging	Het
Dpp6	A	G	5: 27,709,459	D514G	possibly damaging	Het
Dync2h1	A	G	9: 7,129,062	S1818P	probably damaging	Het
Efemp1	A	T	11: 28,914,696	Y250F	possibly damaging	Het
Emc1	G	A	4: 139,360,946	E342K	possibly damaging	Het
Fam214a	A	G	9: 75,010,390	D757G	probably damaging	Het
Fam3c	T	C	6: 22,329,593	D45G	probably benign	Het
Fchsd2	A	C	7: 101,198,533	D210A	possibly damaging	Het
Flg	T	A	3: 93,279,415	M58K	probably damaging	Het
Gabra5	G	A	7: 57,488,950	R117C	probably damaging	Het
Gm6741	G	A	17: 91,236,881	S24N	probably benign	Het
Grin2a	T	C	16: 9,644,243	D675G	possibly damaging	Het
Hectd4	T	G	5: 121,281,918	V642G	possibly damaging	Het
Herc6	C	T	6: 57,583,332	T119M	probably benign	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hmgcs2	T	C	3: 98,299,214	S371P	probably damaging	Het
Idua	C	T	5: 108,680,734	A271V	probably damaging	Het
Inpp5d	T	A	1: 87,695,350	C125*	probably null	Het
Krt14	C	T	11: 100,207,218	G80R	unknown	Het
Lama5	T	C	2: 180,179,130	Y3176C	probably benign	Het
Lce1k	C	T	3: 92,806,502	C125Y	unknown	Het
Lig4	A	T	8: 9,972,436	L448Q	probably damaging	Het
Macf1	C	T	4: 123,371,918	A4821T	probably damaging	Het
Meioc	C	T	11: 102,675,358	A600V	probably benign	Het
Mepe	T	C	5: 104,327,091	S13P	possibly damaging	Het
Mms22l	A	G	4: 24,588,365	Y999C	probably damaging	Het
Ncbp3	T	A	11: 73,053,520	M116K	possibly damaging	Het
Ndufa10	A	G	1: 92,439,892	Y339H	probably damaging	Het
Nkx3-1	T	C	14: 69,190,817	I38T	probably damaging	Het
Nup155	A	T	15: 8,157,760	H1391L	probably damaging	Het
Olfr1299	T	A	2: 111,664,823	M199K	possibly damaging	Het
Pdss2	A	T	10: 43,393,875	N238I	possibly damaging	Het
Pkd1l2	A	G	8: 117,019,533	V1906A	probably benign	Het
Pom121	T	C	5: 135,381,550		probably benign	Het
Psmd9	T	C	5: 123,241,862	F115L	probably damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Rai1	T	C	11: 60,185,589	F160L	probably damaging	Het
Rhbdl2	A	T	4: 123,826,872	R234S	probably damaging	Het
Rnase2a	T	A	14: 51,255,788	Y40F	probably damaging	Het
Setd2	T	C	9: 110,549,133	V672A	possibly damaging	Het
Sgpp2	A	G	1: 78,417,220	I287V	probably benign	Het
Sh3pxd2a	T	C	19: 47,267,264	E1033G	probably benign	Het
Slc5a9	G	A	4: 111,890,531	T284I	probably damaging	Het
Slfn9	A	G	11: 82,981,681	L743P	probably damaging	Het
Smchd1	T	A	17: 71,370,928	N1473I	probably benign	Het
Stx1b	A	T	7: 127,815,403	D16E	probably benign	Het
Tectb	T	C	19: 55,181,929	F71L	probably damaging	Het
Tmem220	T	C	11: 67,034,153	I138T	possibly damaging	Het
Tmtc4	T	C	14: 122,921,265	N682S	probably benign	Het
Tnc	A	G	4: 63,964,621	V1921A	probably damaging	Het
Ubn1	T	G	16: 5,064,623	L316W	probably damaging	Het
Vwa5a	T	C	9: 38,736,061	S579P	probably damaging	Het
Xdh	A	G	17: 73,921,305	L367P	possibly damaging	Het
Zfp280b	T	C	10: 76,038,494	L69S	probably damaging	Het
Zfp990	A	C	4: 145,537,404	Y324S	possibly damaging	Het

Other mutations in Padi6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00778:Padi6	APN	4	140727623	missense	possibly damaging	0.56
IGL01013:Padi6	APN	4	140729003	missense	probably damaging	0.98
IGL01068:Padi6	APN	4	140730953	missense	possibly damaging	0.70
IGL01945:Padi6	APN	4	140741924	missense	probably benign	0.24
streetwise	UTSW	4	140741558	nonsense	probably null
R0097:Padi6	UTSW	4	140730957	missense	probably benign	0.09
R0097:Padi6	UTSW	4	140730957	missense	probably benign	0.09
R0135:Padi6	UTSW	4	140737352	missense	probably benign	0.04
R0437:Padi6	UTSW	4	140728929	missense	probably benign	0.01
R1581:Padi6	UTSW	4	140735836	missense	probably damaging	1.00
R3150:Padi6	UTSW	4	140735389	missense	probably damaging	1.00
R3176:Padi6	UTSW	4	140735389	missense	probably damaging	1.00
R3177:Padi6	UTSW	4	140735389	missense	probably damaging	1.00
R3276:Padi6	UTSW	4	140735389	missense	probably damaging	1.00
R3277:Padi6	UTSW	4	140735389	missense	probably damaging	1.00
R4168:Padi6	UTSW	4	140741934	missense	probably damaging	0.99
R4727:Padi6	UTSW	4	140731195	missense	probably damaging	1.00
R5063:Padi6	UTSW	4	140741880	missense	probably benign	0.01
R5382:Padi6	UTSW	4	140731210	missense	probably damaging	1.00
R5408:Padi6	UTSW	4	140727685	missense	probably damaging	1.00
R5604:Padi6	UTSW	4	140731162	missense	probably damaging	0.96
R5790:Padi6	UTSW	4	140732258	missense	probably damaging	1.00
R7084:Padi6	UTSW	4	140741558	nonsense	probably null
R7533:Padi6	UTSW	4	140731195	missense	probably damaging	1.00
R7581:Padi6	UTSW	4	140728929	missense	probably benign	0.01
R7662:Padi6	UTSW	4	140728995	missense	probably benign	0.00
R7766:Padi6	UTSW	4	140730975	missense	probably benign	0.02
R7872:Padi6	UTSW	4	140727762	missense	probably damaging	1.00
R7955:Padi6	UTSW	4	140727762	missense	probably damaging	1.00
RF007:Padi6	UTSW	4	140729743	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTAAGCACATGAACCTGGG -3'
(R):5'- ACTCCTGGCTCACAAGATTTG -3'

Sequencing Primer
(F):5'- TCCAATACAGTCTCGAACTATCCAGG -3'
(R):5'- GAGCCAAATGGTTCTCTGGGAC -3'

Posted On

2014-08-25