Mutagenetix > Incidental Mutations

Incidental Mutation 'R1984:Aox3'

220253

Institutional Source

Beutler Lab

Gene Symbol

Aox3

Ensembl Gene

ENSMUSG00000064294

Gene Name

aldehyde oxidase 3

Synonyms

AOH1, 1200011D03Rik

MMRRC Submission

039996-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1984 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

58113130-58200698 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 58153061 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 497 (I497F)

Ref Sequence

ENSEMBL: ENSMUSP00000049391 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040999]

PDB Structure

Crystal structure of the mouse liver Aldehyde Oxidase 3 (mAOX3) [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000040999
AA Change: I497F

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000049391
Gene: ENSMUSG00000064294
AA Change: I497F

Domain	Start	End	E-Value	Type
Pfam:Fer2	12	82	1.4e-9	PFAM
Pfam:Fer2_2	91	165	1e-29	PFAM
Pfam:FAD_binding_5	239	419	1e-44	PFAM
CO_deh_flav_C	426	530	9.26e-24	SMART
Ald_Xan_dh_C	594	697	2.27e-41	SMART
Pfam:Ald_Xan_dh_C2	708	1241	8.7e-183	PFAM
low complexity region	1275	1286	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158650

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 94.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013D24Rik	A	T	6: 124,347,819	L81H	probably damaging	Het
Abca8b	A	G	11: 109,977,841	C166R	probably damaging	Het
Adgrv1	T	A	13: 81,523,749	E2242D	probably damaging	Het
Agap1	T	C	1: 89,766,323	S448P	probably benign	Het
AI464131	C	A	4: 41,497,501	A710S	possibly damaging	Het
Aldh1a2	T	C	9: 71,253,052	L120P	probably damaging	Het
Alkbh2	T	C	5: 114,124,054	N205S	probably benign	Het
Anapc1	C	A	2: 128,669,688	G493C	possibly damaging	Het
Atp2b1	T	C	10: 99,014,492	S826P	possibly damaging	Het
Atp8b4	T	A	2: 126,323,008	R1129S	probably damaging	Het
Bche	T	A	3: 73,701,826	Q89L	probably benign	Het
Bche	G	T	3: 73,701,827	Q89K	probably benign	Het
Bcl9	T	C	3: 97,213,734	K171E	probably damaging	Het
Cacna1b	A	T	2: 24,648,986	Y1488N	probably damaging	Het
Dock8	A	G	19: 25,121,181	N623S	probably null	Het
Dok6	T	C	18: 89,560,110	E61G	probably damaging	Het
Esf1	A	T	2: 140,148,886	D559E	possibly damaging	Het
F11r	A	G	1: 171,461,870	I254V	probably benign	Het
Fkrp	A	G	7: 16,811,877	V20A	probably benign	Het
Fscb	T	C	12: 64,474,683	E3G	unknown	Het
Gm14685	G	T	X: 73,127,655	G218C	probably damaging	Het
Gm4981	T	A	10: 58,235,963	Q143L	possibly damaging	Het
Hdlbp	A	G	1: 93,431,118	I237T	probably damaging	Het
Hfm1	A	T	5: 106,898,576	D481E	probably damaging	Het
Hspa4l	T	C	3: 40,760,401	V156A	probably damaging	Het
Igfn1	A	G	1: 135,962,044	S2422P	probably benign	Het
Il23r	T	A	6: 67,490,668		probably null	Het
Il24	G	A	1: 130,882,531	T196I	probably benign	Het
Isg15	T	C	4: 156,199,793	I93V	probably benign	Het
Kcna6	T	C	6: 126,738,510	E472G	probably benign	Het
Kif21b	G	A	1: 136,147,546	D166N	probably damaging	Het
Lilr4b	A	T	10: 51,481,735	Q80L	possibly damaging	Het
Lrrc69	T	C	4: 14,708,669	E225G	possibly damaging	Het
March6	A	T	15: 31,469,646	L726Q	probably damaging	Het
Megf6	G	T	4: 154,267,667	G1210C	probably damaging	Het
Msh2	C	T	17: 87,719,296	T740I	probably damaging	Het
Myh14	T	C	7: 44,639,022	Y514C	probably damaging	Het
Nedd1	T	C	10: 92,714,160	T88A	possibly damaging	Het
Nfkb1	G	A	3: 135,615,349	T215I	possibly damaging	Het
Obox1	A	T	7: 15,555,210	I17L	probably benign	Het
Olfr739	A	T	14: 50,425,391	I291L	possibly damaging	Het
Palb2	A	C	7: 122,127,080	H522Q	probably damaging	Het
Pde4c	C	T	8: 70,724,542	T6M	probably damaging	Het
Plekhg1	A	G	10: 3,958,181	K97E	probably damaging	Het
Plod3	A	G	5: 136,990,853		probably null	Het
Plppr3	A	T	10: 79,867,460	Y63*	probably null	Het
Qrich1	T	C	9: 108,534,047	V257A	probably damaging	Het
Rpl14	A	G	9: 120,572,187	D32G	possibly damaging	Het
Senp8	A	G	9: 59,737,438	V132A	possibly damaging	Het
Serac1	A	G	17: 6,045,689		probably null	Het
Sh2d3c	T	A	2: 32,749,244	C295*	probably null	Het
Stab1	A	G	14: 31,150,648	F1142L	probably benign	Het
Stam2	T	C	2: 52,709,626	T257A	possibly damaging	Het
Tedc2	T	A	17: 24,216,317	E366V	probably damaging	Het
Tedc2	C	A	17: 24,216,318	E366*	probably null	Het
Tg	A	G	15: 66,682,842	E702G	probably benign	Het
Tgif2lx2	A	T	X: 118,427,993	K218*	probably null	Het
Tpp1	C	A	7: 105,751,698	V41L	probably benign	Het
Tulp3	A	T	6: 128,326,806	S277T	probably benign	Het
Zfp407	C	T	18: 84,559,773	A1072T	probably benign	Het
Zfp683	T	C	4: 134,057,455	F338L	probably damaging	Het

Other mutations in Aox3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01599:Aox3	APN	1	58169794	missense	probably damaging	1.00
IGL01747:Aox3	APN	1	58159658	missense	probably damaging	0.97
IGL01883:Aox3	APN	1	58138283	missense	probably damaging	1.00
IGL01911:Aox3	APN	1	58152560	missense	probably benign	0.04
IGL02017:Aox3	APN	1	58120992	missense	probably damaging	1.00
IGL02120:Aox3	APN	1	58127650	missense	probably benign	0.00
IGL02466:Aox3	APN	1	58158272	missense	probably benign	0.28
IGL02545:Aox3	APN	1	58183486	missense	probably damaging	1.00
IGL02572:Aox3	APN	1	58158367	missense	probably damaging	1.00
IGL02746:Aox3	APN	1	58183542	missense	possibly damaging	0.83
IGL02808:Aox3	APN	1	58142700	missense	probably damaging	0.99
IGL02812:Aox3	APN	1	58165896	missense	probably benign	0.00
IGL02982:Aox3	APN	1	58127687	missense	probably benign	0.00
IGL03056:Aox3	APN	1	58159021	critical splice donor site	probably null
IGL03182:Aox3	APN	1	58165887	missense	probably benign	0.02
IGL03234:Aox3	APN	1	58152686	missense	probably benign
IGL03374:Aox3	APN	1	58171848	missense	probably damaging	1.00
amber	UTSW	1	58171891	nonsense	probably null
R0071:Aox3	UTSW	1	58171891	nonsense	probably null
R0071:Aox3	UTSW	1	58171891	nonsense	probably null
R0135:Aox3	UTSW	1	58125088	splice site	probably benign
R0332:Aox3	UTSW	1	58142751	missense	probably benign	0.00
R0626:Aox3	UTSW	1	58172299	missense	possibly damaging	0.94
R1325:Aox3	UTSW	1	58176567	nonsense	probably null
R1435:Aox3	UTSW	1	58163446	critical splice donor site	probably null
R1438:Aox3	UTSW	1	58153178	missense	probably benign
R1567:Aox3	UTSW	1	58194693	missense	probably damaging	0.96
R1575:Aox3	UTSW	1	58152554	missense	probably benign	0.04
R1759:Aox3	UTSW	1	58170646	splice site	probably null
R1785:Aox3	UTSW	1	58169843	missense	probably damaging	1.00
R1786:Aox3	UTSW	1	58169843	missense	probably damaging	1.00
R1921:Aox3	UTSW	1	58180651	missense	probably damaging	1.00
R2012:Aox3	UTSW	1	58138232	missense	probably benign	0.02
R2080:Aox3	UTSW	1	58186280	missense	probably benign	0.06
R2121:Aox3	UTSW	1	58152549	splice site	probably benign
R2126:Aox3	UTSW	1	58158216	missense	probably benign	0.25
R2130:Aox3	UTSW	1	58169843	missense	probably damaging	1.00
R2131:Aox3	UTSW	1	58169843	missense	probably damaging	1.00
R2132:Aox3	UTSW	1	58169843	missense	probably damaging	1.00
R2133:Aox3	UTSW	1	58169843	missense	probably damaging	1.00
R2385:Aox3	UTSW	1	58138289	missense	probably damaging	1.00
R2495:Aox3	UTSW	1	58188408	missense	probably damaging	0.99
R4200:Aox3	UTSW	1	58188378	missense	probably damaging	1.00
R4231:Aox3	UTSW	1	58114885	missense	probably benign	0.12
R4591:Aox3	UTSW	1	58152656	missense	probably damaging	0.99
R4627:Aox3	UTSW	1	58125035	missense	probably damaging	0.98
R4831:Aox3	UTSW	1	58152566	missense	probably damaging	0.97
R4864:Aox3	UTSW	1	58176487	missense	probably damaging	1.00
R4976:Aox3	UTSW	1	58188524	critical splice donor site	probably null
R5007:Aox3	UTSW	1	58163424	missense	probably benign
R5119:Aox3	UTSW	1	58188524	critical splice donor site	probably null
R5175:Aox3	UTSW	1	58172328	missense	probably benign	0.01
R5360:Aox3	UTSW	1	58146508	missense	probably damaging	1.00
R5784:Aox3	UTSW	1	58153499	missense	probably benign	0.00
R6050:Aox3	UTSW	1	58180655	missense	possibly damaging	0.93
R6056:Aox3	UTSW	1	58169859	missense	probably damaging	1.00
R6162:Aox3	UTSW	1	58159731	missense	possibly damaging	0.75
R6181:Aox3	UTSW	1	58158946	missense	probably benign	0.03
R6374:Aox3	UTSW	1	58172161	missense	probably benign	0.11
R6662:Aox3	UTSW	1	58118615	missense	probably damaging	1.00
R6809:Aox3	UTSW	1	58118681	missense	probably damaging	0.99
R6810:Aox3	UTSW	1	58141431	missense	probably benign	0.00
R6821:Aox3	UTSW	1	58150388	missense	probably benign	0.04
R7039:Aox3	UTSW	1	58176555	missense	probably damaging	1.00
R7116:Aox3	UTSW	1	58153530	missense	probably benign	0.01
R7146:Aox3	UTSW	1	58158529	splice site	probably null
R7163:Aox3	UTSW	1	58119512	missense	probably damaging	0.99
R7243:Aox3	UTSW	1	58138307	missense	unknown
R7319:Aox3	UTSW	1	58152602	missense	probably benign	0.04
R7423:Aox3	UTSW	1	58121069	missense	possibly damaging	0.80
R7664:Aox3	UTSW	1	58119539	missense	probably damaging	1.00
R7709:Aox3	UTSW	1	58180651	missense	probably damaging	1.00
R7745:Aox3	UTSW	1	58176517	missense	possibly damaging	0.75
R7751:Aox3	UTSW	1	58179335	missense	probably benign	0.11
R7912:Aox3	UTSW	1	58142696	missense	probably benign	0.05
R7940:Aox3	UTSW	1	58188437	missense	probably damaging	1.00
R8143:Aox3	UTSW	1	58158915	missense	probably benign	0.05
R8178:Aox3	UTSW	1	58150322	missense	possibly damaging	0.64

Predicted Primers

PCR Primer
(F):5'- GATGGGTGTCATGAGAGTCC -3'
(R):5'- CGGAAATGTAGCCTGCAAACAG -3'

Sequencing Primer
(F):5'- AGTCCTGTGTGAGAAAATAGGTTG -3'
(R):5'- TGACGTCAGCACATGGTG -3'

Posted On

2014-08-25