Incidental Mutation 'R2024:Idua'
ID220262
Institutional Source Beutler Lab
Gene Symbol Idua
Ensembl Gene ENSMUSG00000033540
Gene Nameiduronidase, alpha-L-
Synonyms
MMRRC Submission 040033-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R2024 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location108660331-108684557 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 108680734 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 271 (A271V)
Ref Sequence ENSEMBL: ENSMUSP00000113190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071650] [ENSMUST00000112563] [ENSMUST00000119212] [ENSMUST00000139734] [ENSMUST00000140620]
Predicted Effect probably damaging
Transcript: ENSMUST00000071650
AA Change: A318V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071577
Gene: ENSMUSG00000033540
AA Change: A318V

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 542 1.4e-223 PFAM
SCOP:d1bpv__ 546 643 3e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112563
AA Change: A318V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108182
Gene: ENSMUSG00000033540
AA Change: A318V

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 542 2.1e-224 PFAM
SCOP:d1bpv__ 546 643 3e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119212
AA Change: A271V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113190
Gene: ENSMUSG00000033540
AA Change: A271V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Glyco_hydro_39 48 495 2.4e-193 PFAM
SCOP:d1bpv__ 499 596 3e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133482
Predicted Effect probably benign
Transcript: ENSMUST00000139734
SMART Domains Protein: ENSMUSP00000117694
Gene: ENSMUSG00000033540

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 199 6.8e-80 PFAM
low complexity region 235 260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140620
SMART Domains Protein: ENSMUSP00000119624
Gene: ENSMUSG00000033540

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 150 3.4e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151445
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159464
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that hydrolyzes the terminal alpha-L-iduronic acid residues of two glycosaminoglycans, dermatan sulfate and heparan sulfate. This hydrolysis is required for the lysosomal degradation of these glycosaminoglycans. Mutations in this gene that result in enzymatic deficiency lead to the autosomal recessive disease mucopolysaccharidosis type I (MPS I). [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted mutants show lysosomal storage in multiple tissues, increased urinary GAG, craniofacial and skeletal defects, increased body weight, impaired habituation and long-term memory for aversive training, reduced ventricular function with valve insufficiency, and progressive hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid2 A G 15: 96,361,799 D280G probably damaging Het
Azi2 C T 9: 118,049,322 R77* probably null Het
Chd8 T C 14: 52,231,493 D556G probably benign Het
Cit T C 5: 115,947,924 M849T probably damaging Het
Cit T C 5: 116,005,840 S1923P probably damaging Het
Col17a1 T A 19: 47,650,746 H1120L probably benign Het
Col6a5 G T 9: 105,936,994 H606Q unknown Het
Dnajc2 A C 5: 21,776,790 H45Q probably damaging Het
Dpp6 A G 5: 27,709,459 D514G possibly damaging Het
Dync2h1 A G 9: 7,129,062 S1818P probably damaging Het
Efemp1 A T 11: 28,914,696 Y250F possibly damaging Het
Emc1 G A 4: 139,360,946 E342K possibly damaging Het
Fam214a A G 9: 75,010,390 D757G probably damaging Het
Fam3c T C 6: 22,329,593 D45G probably benign Het
Fchsd2 A C 7: 101,198,533 D210A possibly damaging Het
Flg T A 3: 93,279,415 M58K probably damaging Het
Gabra5 G A 7: 57,488,950 R117C probably damaging Het
Gm6741 G A 17: 91,236,881 S24N probably benign Het
Grin2a T C 16: 9,644,243 D675G possibly damaging Het
Hectd4 T G 5: 121,281,918 V642G possibly damaging Het
Herc6 C T 6: 57,583,332 T119M probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hmgcs2 T C 3: 98,299,214 S371P probably damaging Het
Inpp5d T A 1: 87,695,350 C125* probably null Het
Krt14 C T 11: 100,207,218 G80R unknown Het
Lama5 T C 2: 180,179,130 Y3176C probably benign Het
Lce1k C T 3: 92,806,502 C125Y unknown Het
Lig4 A T 8: 9,972,436 L448Q probably damaging Het
Macf1 C T 4: 123,371,918 A4821T probably damaging Het
Meioc C T 11: 102,675,358 A600V probably benign Het
Mepe T C 5: 104,327,091 S13P possibly damaging Het
Mms22l A G 4: 24,588,365 Y999C probably damaging Het
Ncbp3 T A 11: 73,053,520 M116K possibly damaging Het
Ndufa10 A G 1: 92,439,892 Y339H probably damaging Het
Nkx3-1 T C 14: 69,190,817 I38T probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1299 T A 2: 111,664,823 M199K possibly damaging Het
Padi6 T G 4: 140,728,968 I572L possibly damaging Het
Pdss2 A T 10: 43,393,875 N238I possibly damaging Het
Pkd1l2 A G 8: 117,019,533 V1906A probably benign Het
Pom121 T C 5: 135,381,550 probably benign Het
Psmd9 T C 5: 123,241,862 F115L probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rai1 T C 11: 60,185,589 F160L probably damaging Het
Rhbdl2 A T 4: 123,826,872 R234S probably damaging Het
Rnase2a T A 14: 51,255,788 Y40F probably damaging Het
Setd2 T C 9: 110,549,133 V672A possibly damaging Het
Sgpp2 A G 1: 78,417,220 I287V probably benign Het
Sh3pxd2a T C 19: 47,267,264 E1033G probably benign Het
Slc5a9 G A 4: 111,890,531 T284I probably damaging Het
Slfn9 A G 11: 82,981,681 L743P probably damaging Het
Smchd1 T A 17: 71,370,928 N1473I probably benign Het
Stx1b A T 7: 127,815,403 D16E probably benign Het
Tectb T C 19: 55,181,929 F71L probably damaging Het
Tmem220 T C 11: 67,034,153 I138T possibly damaging Het
Tmtc4 T C 14: 122,921,265 N682S probably benign Het
Tnc A G 4: 63,964,621 V1921A probably damaging Het
Ubn1 T G 16: 5,064,623 L316W probably damaging Het
Vwa5a T C 9: 38,736,061 S579P probably damaging Het
Xdh A G 17: 73,921,305 L367P possibly damaging Het
Zfp280b T C 10: 76,038,494 L69S probably damaging Het
Zfp990 A C 4: 145,537,404 Y324S possibly damaging Het
Other mutations in Idua
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Idua APN 5 108680871 missense probably benign 0.34
IGL01575:Idua APN 5 108682107 missense possibly damaging 0.71
IGL02402:Idua APN 5 108679791 missense probably damaging 1.00
IGL03145:Idua APN 5 108681496 missense probably benign
cooper UTSW 5 108680314 missense probably damaging 1.00
R0208:Idua UTSW 5 108681752 missense probably damaging 1.00
R1572:Idua UTSW 5 108680589 missense probably benign
R1731:Idua UTSW 5 108681672 missense probably benign 0.00
R2126:Idua UTSW 5 108681438 missense possibly damaging 0.93
R3760:Idua UTSW 5 108670112 unclassified probably benign
R4747:Idua UTSW 5 108681036 missense probably damaging 0.97
R4832:Idua UTSW 5 108669381 missense probably benign
R5140:Idua UTSW 5 108680314 missense probably damaging 1.00
R5543:Idua UTSW 5 108670229 missense probably benign 0.22
R5643:Idua UTSW 5 108680224 utr 3 prime probably benign
R5821:Idua UTSW 5 108679734 missense probably benign 0.29
R6004:Idua UTSW 5 108680644 missense probably benign
R6330:Idua UTSW 5 108681708 missense probably benign 0.21
R6963:Idua UTSW 5 108679775 missense possibly damaging 0.84
R7180:Idua UTSW 5 108680895 missense probably benign 0.43
R7453:Idua UTSW 5 108681496 missense probably benign
R7575:Idua UTSW 5 108681699 missense probably damaging 1.00
R7712:Idua UTSW 5 108681522 missense probably benign 0.10
R8026:Idua UTSW 5 108670249 missense probably benign 0.01
R8029:Idua UTSW 5 108669412 missense probably benign 0.23
R8074:Idua UTSW 5 108680575 missense possibly damaging 0.65
Z1177:Idua UTSW 5 108679584 missense probably null 0.80
Z1177:Idua UTSW 5 108680623 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGCCTGTACTGAGTGAGGTATG -3'
(R):5'- AGGCATTGTCATTGCTGAGG -3'

Sequencing Primer
(F):5'- CCTGTACTGAGTGAGGTATGTGCTG -3'
(R):5'- CACATAGCGCATGGAGGAACTG -3'
Posted On2014-08-25