Incidental Mutation 'R1984:F11r'
ID220265
Institutional Source Beutler Lab
Gene Symbol F11r
Ensembl Gene ENSMUSG00000038235
Gene NameF11 receptor
SynonymsJcam1, JAM-A, Ly106, ESTM33, BV11 antigen, JAM-1
MMRRC Submission 039996-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R1984 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location171437535-171464603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 171461870 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 254 (I254V)
Ref Sequence ENSEMBL: ENSMUSP00000041907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043839]
PDB Structure
SOLUBLE PART OF THE JUNCTION ADHESION MOLECULE FROM MOUSE [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000043839
AA Change: I254V

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000041907
Gene: ENSMUSG00000038235
AA Change: I254V

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IGv 44 110 9.93e-8 SMART
IGc2 143 219 1.82e-6 SMART
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155913
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Tight junctions represent one mode of cell-to-cell adhesion in epithelial or endothelial cell sheets, forming continuous seals around cells and serving as a physical barrier to prevent solutes and water from passing freely through the paracellular space. The protein encoded by this immunoglobulin superfamily gene member is an important regulator of tight junction assembly in epithelia. In addition, the encoded protein can act as (1) a receptor for reovirus, (2) a ligand for the integrin LFA1, involved in leukocyte transmigration, and (3) a platelet receptor. Multiple 5' alternatively spliced variants, encoding the same protein, have been identified but their biological validity has not been established. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display increased dendritic cell migratory ability and contact hypersensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A T 6: 124,347,819 L81H probably damaging Het
Abca8b A G 11: 109,977,841 C166R probably damaging Het
Adgrv1 T A 13: 81,523,749 E2242D probably damaging Het
Agap1 T C 1: 89,766,323 S448P probably benign Het
AI464131 C A 4: 41,497,501 A710S possibly damaging Het
Aldh1a2 T C 9: 71,253,052 L120P probably damaging Het
Alkbh2 T C 5: 114,124,054 N205S probably benign Het
Anapc1 C A 2: 128,669,688 G493C possibly damaging Het
Aox3 A T 1: 58,153,061 I497F possibly damaging Het
Atp2b1 T C 10: 99,014,492 S826P possibly damaging Het
Atp8b4 T A 2: 126,323,008 R1129S probably damaging Het
Bche T A 3: 73,701,826 Q89L probably benign Het
Bche G T 3: 73,701,827 Q89K probably benign Het
Bcl9 T C 3: 97,213,734 K171E probably damaging Het
Cacna1b A T 2: 24,648,986 Y1488N probably damaging Het
Dock8 A G 19: 25,121,181 N623S probably null Het
Dok6 T C 18: 89,560,110 E61G probably damaging Het
Esf1 A T 2: 140,148,886 D559E possibly damaging Het
Fkrp A G 7: 16,811,877 V20A probably benign Het
Fscb T C 12: 64,474,683 E3G unknown Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm4981 T A 10: 58,235,963 Q143L possibly damaging Het
Hdlbp A G 1: 93,431,118 I237T probably damaging Het
Hfm1 A T 5: 106,898,576 D481E probably damaging Het
Hspa4l T C 3: 40,760,401 V156A probably damaging Het
Igfn1 A G 1: 135,962,044 S2422P probably benign Het
Il23r T A 6: 67,490,668 probably null Het
Il24 G A 1: 130,882,531 T196I probably benign Het
Isg15 T C 4: 156,199,793 I93V probably benign Het
Kcna6 T C 6: 126,738,510 E472G probably benign Het
Kif21b G A 1: 136,147,546 D166N probably damaging Het
Lilr4b A T 10: 51,481,735 Q80L possibly damaging Het
Lrrc69 T C 4: 14,708,669 E225G possibly damaging Het
March6 A T 15: 31,469,646 L726Q probably damaging Het
Megf6 G T 4: 154,267,667 G1210C probably damaging Het
Msh2 C T 17: 87,719,296 T740I probably damaging Het
Myh14 T C 7: 44,639,022 Y514C probably damaging Het
Nedd1 T C 10: 92,714,160 T88A possibly damaging Het
Nfkb1 G A 3: 135,615,349 T215I possibly damaging Het
Obox1 A T 7: 15,555,210 I17L probably benign Het
Olfr739 A T 14: 50,425,391 I291L possibly damaging Het
Palb2 A C 7: 122,127,080 H522Q probably damaging Het
Pde4c C T 8: 70,724,542 T6M probably damaging Het
Plekhg1 A G 10: 3,958,181 K97E probably damaging Het
Plod3 A G 5: 136,990,853 probably null Het
Plppr3 A T 10: 79,867,460 Y63* probably null Het
Qrich1 T C 9: 108,534,047 V257A probably damaging Het
Rpl14 A G 9: 120,572,187 D32G possibly damaging Het
Senp8 A G 9: 59,737,438 V132A possibly damaging Het
Serac1 A G 17: 6,045,689 probably null Het
Sh2d3c T A 2: 32,749,244 C295* probably null Het
Stab1 A G 14: 31,150,648 F1142L probably benign Het
Stam2 T C 2: 52,709,626 T257A possibly damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tg A G 15: 66,682,842 E702G probably benign Het
Tgif2lx2 A T X: 118,427,993 K218* probably null Het
Tpp1 C A 7: 105,751,698 V41L probably benign Het
Tulp3 A T 6: 128,326,806 S277T probably benign Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp683 T C 4: 134,057,455 F338L probably damaging Het
Other mutations in F11r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:F11r APN 1 171462942 critical splice donor site probably null
IGL01431:F11r APN 1 171462909 missense probably damaging 1.00
R0481:F11r UTSW 1 171461279 missense probably benign 0.02
R0486:F11r UTSW 1 171460588 missense probably damaging 1.00
R1944:F11r UTSW 1 171461891 missense probably damaging 1.00
R2423:F11r UTSW 1 171461623 missense possibly damaging 0.89
R3545:F11r UTSW 1 171461261 missense probably damaging 1.00
R3840:F11r UTSW 1 171460889 missense probably damaging 1.00
R3841:F11r UTSW 1 171460889 missense probably damaging 1.00
R4007:F11r UTSW 1 171461348 missense probably benign 0.35
R4744:F11r UTSW 1 171460598 missense probably benign 0.00
R4775:F11r UTSW 1 171461641 missense probably damaging 1.00
R6384:F11r UTSW 1 171460940 missense probably benign 0.01
R8052:F11r UTSW 1 171461623 missense possibly damaging 0.89
R8215:F11r UTSW 1 171463088 makesense probably null
R8217:F11r UTSW 1 171463088 makesense probably null
R8377:F11r UTSW 1 171437543 start gained probably benign
RF063:F11r UTSW 1 171461190 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- GCCTGAGATTAGAGCTTGGG -3'
(R):5'- GGCATCAAGTCCATACTGGG -3'

Sequencing Primer
(F):5'- CTTGGGGTGTGGTCAGAGCC -3'
(R):5'- GGAACATACTATACTGCTGGGTAC -3'
Posted On2014-08-25