Incidental Mutation 'R2024:Psmd9'
ID220271
Institutional Source Beutler Lab
Gene Symbol Psmd9
Ensembl Gene ENSMUSG00000029440
Gene Nameproteasome (prosome, macropain) 26S subunit, non-ATPase, 9
Synonyms1500011J20Rik, P27, Bridge-1
MMRRC Submission 040033-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.415) question?
Stock #R2024 (G1)
Quality Score222
Status Not validated
Chromosome5
Chromosomal Location123169413-123250131 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123241862 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 115 (F115L)
Ref Sequence ENSEMBL: ENSMUSP00000143635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100729] [ENSMUST00000197809] [ENSMUST00000198183]
Predicted Effect probably damaging
Transcript: ENSMUST00000100729
AA Change: F161L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098295
Gene: ENSMUSG00000029440
AA Change: F161L

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
Blast:PDZ 20 58 7e-7 BLAST
PDB:3WHL|H 23 99 2e-12 PDB
PDZ 121 195 5.02e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133386
Predicted Effect probably damaging
Transcript: ENSMUST00000197809
AA Change: F115L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143635
Gene: ENSMUSG00000029440
AA Change: F115L

DomainStartEndE-ValueType
PDB:3WHL|H 1 53 9e-8 PDB
PDZ 75 148 1.5e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000198183
AA Change: F10L

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142433
Gene: ENSMUSG00000029440
AA Change: F10L

DomainStartEndE-ValueType
Blast:PDZ 1 45 6e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199260
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a non-ATPase subunit of the 19S regulator. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid2 A G 15: 96,361,799 D280G probably damaging Het
Azi2 C T 9: 118,049,322 R77* probably null Het
Chd8 T C 14: 52,231,493 D556G probably benign Het
Cit T C 5: 115,947,924 M849T probably damaging Het
Cit T C 5: 116,005,840 S1923P probably damaging Het
Col17a1 T A 19: 47,650,746 H1120L probably benign Het
Col6a5 G T 9: 105,936,994 H606Q unknown Het
Dnajc2 A C 5: 21,776,790 H45Q probably damaging Het
Dpp6 A G 5: 27,709,459 D514G possibly damaging Het
Dync2h1 A G 9: 7,129,062 S1818P probably damaging Het
Efemp1 A T 11: 28,914,696 Y250F possibly damaging Het
Emc1 G A 4: 139,360,946 E342K possibly damaging Het
Fam214a A G 9: 75,010,390 D757G probably damaging Het
Fam3c T C 6: 22,329,593 D45G probably benign Het
Fchsd2 A C 7: 101,198,533 D210A possibly damaging Het
Flg T A 3: 93,279,415 M58K probably damaging Het
Gabra5 G A 7: 57,488,950 R117C probably damaging Het
Gm6741 G A 17: 91,236,881 S24N probably benign Het
Grin2a T C 16: 9,644,243 D675G possibly damaging Het
Hectd4 T G 5: 121,281,918 V642G possibly damaging Het
Herc6 C T 6: 57,583,332 T119M probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hmgcs2 T C 3: 98,299,214 S371P probably damaging Het
Idua C T 5: 108,680,734 A271V probably damaging Het
Inpp5d T A 1: 87,695,350 C125* probably null Het
Krt14 C T 11: 100,207,218 G80R unknown Het
Lama5 T C 2: 180,179,130 Y3176C probably benign Het
Lce1k C T 3: 92,806,502 C125Y unknown Het
Lig4 A T 8: 9,972,436 L448Q probably damaging Het
Macf1 C T 4: 123,371,918 A4821T probably damaging Het
Meioc C T 11: 102,675,358 A600V probably benign Het
Mepe T C 5: 104,327,091 S13P possibly damaging Het
Mms22l A G 4: 24,588,365 Y999C probably damaging Het
Ncbp3 T A 11: 73,053,520 M116K possibly damaging Het
Ndufa10 A G 1: 92,439,892 Y339H probably damaging Het
Nkx3-1 T C 14: 69,190,817 I38T probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1299 T A 2: 111,664,823 M199K possibly damaging Het
Padi6 T G 4: 140,728,968 I572L possibly damaging Het
Pdss2 A T 10: 43,393,875 N238I possibly damaging Het
Pkd1l2 A G 8: 117,019,533 V1906A probably benign Het
Pom121 T C 5: 135,381,550 probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rai1 T C 11: 60,185,589 F160L probably damaging Het
Rhbdl2 A T 4: 123,826,872 R234S probably damaging Het
Rnase2a T A 14: 51,255,788 Y40F probably damaging Het
Setd2 T C 9: 110,549,133 V672A possibly damaging Het
Sgpp2 A G 1: 78,417,220 I287V probably benign Het
Sh3pxd2a T C 19: 47,267,264 E1033G probably benign Het
Slc5a9 G A 4: 111,890,531 T284I probably damaging Het
Slfn9 A G 11: 82,981,681 L743P probably damaging Het
Smchd1 T A 17: 71,370,928 N1473I probably benign Het
Stx1b A T 7: 127,815,403 D16E probably benign Het
Tectb T C 19: 55,181,929 F71L probably damaging Het
Tmem220 T C 11: 67,034,153 I138T possibly damaging Het
Tmtc4 T C 14: 122,921,265 N682S probably benign Het
Tnc A G 4: 63,964,621 V1921A probably damaging Het
Ubn1 T G 16: 5,064,623 L316W probably damaging Het
Vwa5a T C 9: 38,736,061 S579P probably damaging Het
Xdh A G 17: 73,921,305 L367P possibly damaging Het
Zfp280b T C 10: 76,038,494 L69S probably damaging Het
Zfp990 A C 4: 145,537,404 Y324S possibly damaging Het
Other mutations in Psmd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01976:Psmd9 APN 5 123234634 missense probably damaging 0.99
IGL02354:Psmd9 APN 5 123248316 missense probably damaging 1.00
IGL02361:Psmd9 APN 5 123248316 missense probably damaging 1.00
IGL02947:Psmd9 APN 5 123246215 missense probably benign 0.01
R0318:Psmd9 UTSW 5 123234649 missense possibly damaging 0.58
R1491:Psmd9 UTSW 5 123228347 missense probably benign
R1598:Psmd9 UTSW 5 123241917 missense probably damaging 1.00
R3811:Psmd9 UTSW 5 123234590 unclassified probably benign
R3816:Psmd9 UTSW 5 123234590 unclassified probably benign
R3879:Psmd9 UTSW 5 123234590 unclassified probably benign
R3880:Psmd9 UTSW 5 123234590 unclassified probably benign
R8004:Psmd9 UTSW 5 123241935 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CGAGGAGTTGAAATCTTTGACC -3'
(R):5'- AACTGTGTCATCCTTGGACCAG -3'

Sequencing Primer
(F):5'- GACCTCGTTACTTAGAGCCTG -3'
(R):5'- TTGGACCAGAGCCTGAATCTG -3'
Posted On2014-08-25