Incidental Mutation 'R1984:Atp8b4'
ID220274
Institutional Source Beutler Lab
Gene Symbol Atp8b4
Ensembl Gene ENSMUSG00000060131
Gene NameATPase, class I, type 8B, member 4
SynonymsIm
MMRRC Submission 039996-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R1984 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location126320973-126500674 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 126323008 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 1129 (R1129S)
Ref Sequence ENSEMBL: ENSMUSP00000047302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040128] [ENSMUST00000040149]
Predicted Effect probably damaging
Transcript: ENSMUST00000040128
AA Change: R1129S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000046444
Gene: ENSMUSG00000060131
AA Change: R1129S

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 15 81 3.4e-30 PFAM
Pfam:E1-E2_ATPase 81 352 5.1e-8 PFAM
Pfam:HAD 390 826 1.1e-18 PFAM
Pfam:Cation_ATPase 474 573 5.5e-10 PFAM
Pfam:PhoLip_ATPase_C 843 1097 1.6e-83 PFAM
low complexity region 1113 1130 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000040149
AA Change: R1129S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047302
Gene: ENSMUSG00000060131
AA Change: R1129S

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 15 81 3.4e-30 PFAM
Pfam:E1-E2_ATPase 81 352 5.1e-8 PFAM
Pfam:HAD 390 826 1.1e-18 PFAM
Pfam:Cation_ATPase 474 573 5.5e-10 PFAM
Pfam:PhoLip_ATPase_C 843 1097 1.6e-83 PFAM
low complexity region 1113 1130 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cation transport ATPase (P-type) family and type IV subfamily. The encoded protein is involved in phospholipid transport in the cell membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A T 6: 124,347,819 L81H probably damaging Het
Abca8b A G 11: 109,977,841 C166R probably damaging Het
Adgrv1 T A 13: 81,523,749 E2242D probably damaging Het
Agap1 T C 1: 89,766,323 S448P probably benign Het
AI464131 C A 4: 41,497,501 A710S possibly damaging Het
Aldh1a2 T C 9: 71,253,052 L120P probably damaging Het
Alkbh2 T C 5: 114,124,054 N205S probably benign Het
Anapc1 C A 2: 128,669,688 G493C possibly damaging Het
Aox3 A T 1: 58,153,061 I497F possibly damaging Het
Atp2b1 T C 10: 99,014,492 S826P possibly damaging Het
Bche T A 3: 73,701,826 Q89L probably benign Het
Bche G T 3: 73,701,827 Q89K probably benign Het
Bcl9 T C 3: 97,213,734 K171E probably damaging Het
Cacna1b A T 2: 24,648,986 Y1488N probably damaging Het
Dock8 A G 19: 25,121,181 N623S probably null Het
Dok6 T C 18: 89,560,110 E61G probably damaging Het
Esf1 A T 2: 140,148,886 D559E possibly damaging Het
F11r A G 1: 171,461,870 I254V probably benign Het
Fkrp A G 7: 16,811,877 V20A probably benign Het
Fscb T C 12: 64,474,683 E3G unknown Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm4981 T A 10: 58,235,963 Q143L possibly damaging Het
Hdlbp A G 1: 93,431,118 I237T probably damaging Het
Hfm1 A T 5: 106,898,576 D481E probably damaging Het
Hspa4l T C 3: 40,760,401 V156A probably damaging Het
Igfn1 A G 1: 135,962,044 S2422P probably benign Het
Il23r T A 6: 67,490,668 probably null Het
Il24 G A 1: 130,882,531 T196I probably benign Het
Isg15 T C 4: 156,199,793 I93V probably benign Het
Kcna6 T C 6: 126,738,510 E472G probably benign Het
Kif21b G A 1: 136,147,546 D166N probably damaging Het
Lilr4b A T 10: 51,481,735 Q80L possibly damaging Het
Lrrc69 T C 4: 14,708,669 E225G possibly damaging Het
March6 A T 15: 31,469,646 L726Q probably damaging Het
Megf6 G T 4: 154,267,667 G1210C probably damaging Het
Msh2 C T 17: 87,719,296 T740I probably damaging Het
Myh14 T C 7: 44,639,022 Y514C probably damaging Het
Nedd1 T C 10: 92,714,160 T88A possibly damaging Het
Nfkb1 G A 3: 135,615,349 T215I possibly damaging Het
Obox1 A T 7: 15,555,210 I17L probably benign Het
Olfr739 A T 14: 50,425,391 I291L possibly damaging Het
Palb2 A C 7: 122,127,080 H522Q probably damaging Het
Pde4c C T 8: 70,724,542 T6M probably damaging Het
Plekhg1 A G 10: 3,958,181 K97E probably damaging Het
Plod3 A G 5: 136,990,853 probably null Het
Plppr3 A T 10: 79,867,460 Y63* probably null Het
Qrich1 T C 9: 108,534,047 V257A probably damaging Het
Rpl14 A G 9: 120,572,187 D32G possibly damaging Het
Senp8 A G 9: 59,737,438 V132A possibly damaging Het
Serac1 A G 17: 6,045,689 probably null Het
Sh2d3c T A 2: 32,749,244 C295* probably null Het
Stab1 A G 14: 31,150,648 F1142L probably benign Het
Stam2 T C 2: 52,709,626 T257A possibly damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tg A G 15: 66,682,842 E702G probably benign Het
Tgif2lx2 A T X: 118,427,993 K218* probably null Het
Tpp1 C A 7: 105,751,698 V41L probably benign Het
Tulp3 A T 6: 128,326,806 S277T probably benign Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp683 T C 4: 134,057,455 F338L probably damaging Het
Other mutations in Atp8b4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Atp8b4 APN 2 126358897 missense probably damaging 1.00
IGL00841:Atp8b4 APN 2 126383769 missense probably damaging 0.97
IGL00917:Atp8b4 APN 2 126374533 missense probably benign 0.00
IGL01013:Atp8b4 APN 2 126323087 missense probably benign 0.25
IGL01374:Atp8b4 APN 2 126383657 splice site probably benign
IGL01898:Atp8b4 APN 2 126389361 missense probably benign 0.00
IGL01927:Atp8b4 APN 2 126322976 missense probably damaging 0.99
IGL01971:Atp8b4 APN 2 126462616 missense probably benign 0.05
R0320:Atp8b4 UTSW 2 126459694 missense possibly damaging 0.55
R0441:Atp8b4 UTSW 2 126378706 splice site probably benign
R0526:Atp8b4 UTSW 2 126427363 missense probably damaging 1.00
R0765:Atp8b4 UTSW 2 126372150 splice site probably null
R0964:Atp8b4 UTSW 2 126337493 missense probably damaging 1.00
R1386:Atp8b4 UTSW 2 126378744 missense probably benign 0.00
R1401:Atp8b4 UTSW 2 126323093 critical splice acceptor site probably null
R1568:Atp8b4 UTSW 2 126325394 missense probably benign
R1792:Atp8b4 UTSW 2 126325294 missense probably benign
R1830:Atp8b4 UTSW 2 126403381 missense probably benign 0.03
R1839:Atp8b4 UTSW 2 126361782 missense possibly damaging 0.92
R2143:Atp8b4 UTSW 2 126374510 missense probably damaging 1.00
R2186:Atp8b4 UTSW 2 126358860 missense probably damaging 1.00
R2212:Atp8b4 UTSW 2 126375757 missense probably damaging 1.00
R2473:Atp8b4 UTSW 2 126358894 missense possibly damaging 0.67
R3412:Atp8b4 UTSW 2 126375757 missense probably damaging 1.00
R3414:Atp8b4 UTSW 2 126375757 missense probably damaging 1.00
R4519:Atp8b4 UTSW 2 126414459 splice site probably null
R4543:Atp8b4 UTSW 2 126358066 missense probably damaging 0.97
R4701:Atp8b4 UTSW 2 126414293 missense probably damaging 1.00
R4818:Atp8b4 UTSW 2 126322816 missense probably benign 0.01
R4895:Atp8b4 UTSW 2 126414369 missense probably benign 0.23
R5213:Atp8b4 UTSW 2 126389409 splice site probably null
R5239:Atp8b4 UTSW 2 126392861 splice site probably null
R5241:Atp8b4 UTSW 2 126383726 missense probably benign
R5654:Atp8b4 UTSW 2 126375805 missense probably damaging 1.00
R5725:Atp8b4 UTSW 2 126433936 missense probably benign
R5771:Atp8b4 UTSW 2 126378744 missense probably benign 0.11
R5949:Atp8b4 UTSW 2 126405322 missense probably benign 0.02
R5993:Atp8b4 UTSW 2 126403234 missense probably benign
R5998:Atp8b4 UTSW 2 126433867 splice site probably null
R6550:Atp8b4 UTSW 2 126424193 missense probably damaging 1.00
R6575:Atp8b4 UTSW 2 126414364 missense probably damaging 1.00
R6892:Atp8b4 UTSW 2 126343002 missense possibly damaging 0.94
R6915:Atp8b4 UTSW 2 126358914 nonsense probably null
R7045:Atp8b4 UTSW 2 126372195 missense probably benign 0.00
R7206:Atp8b4 UTSW 2 126458292 missense probably damaging 0.99
R7349:Atp8b4 UTSW 2 126325345 missense probably benign 0.00
R7395:Atp8b4 UTSW 2 126375694 missense possibly damaging 0.76
R7429:Atp8b4 UTSW 2 126403371 missense possibly damaging 0.47
R7430:Atp8b4 UTSW 2 126403371 missense possibly damaging 0.47
R7548:Atp8b4 UTSW 2 126389342 missense probably benign
R7724:Atp8b4 UTSW 2 126322893 missense possibly damaging 0.87
R8770:Atp8b4 UTSW 2 126342995 missense probably damaging 1.00
R8793:Atp8b4 UTSW 2 126389334 missense probably benign
R8816:Atp8b4 UTSW 2 126372164 critical splice donor site probably benign
Z1176:Atp8b4 UTSW 2 126414429 missense possibly damaging 0.62
Z1177:Atp8b4 UTSW 2 126322824 missense probably benign 0.06
Z1177:Atp8b4 UTSW 2 126433943 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAAAGACGGCTTTGTGGTCAAG -3'
(R):5'- AAATGGCTTCCGTTTTACTCG -3'

Sequencing Primer
(F):5'- GTCTTATCATGACTAAAGCCGC -3'
(R):5'- GCTTCCGTTTTACTCGGTGGC -3'
Posted On2014-08-25