Incidental Mutation 'R1984:Hspa4l'
ID 220283
Institutional Source Beutler Lab
Gene Symbol Hspa4l
Ensembl Gene ENSMUSG00000025757
Gene Name heat shock protein 4 like
Synonyms Osp94, APG-1, 94kDa
MMRRC Submission 039996-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.230) question?
Stock # R1984 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 40699814-40750538 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 40714833 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 156 (V156A)
Ref Sequence ENSEMBL: ENSMUSP00000144787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108086] [ENSMUST00000203353] [ENSMUST00000203496] [ENSMUST00000203904] [ENSMUST00000204702]
AlphaFold P48722
Predicted Effect probably damaging
Transcript: ENSMUST00000077083
AA Change: V156A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000076336
Gene: ENSMUSG00000025757
AA Change: V156A

DomainStartEndE-ValueType
Pfam:HSP70 3 694 1.3e-192 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108086
AA Change: V135A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103721
Gene: ENSMUSG00000025757
AA Change: V135A

DomainStartEndE-ValueType
Pfam:HSP70 11 673 2.1e-171 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203267
Predicted Effect probably damaging
Transcript: ENSMUST00000203353
AA Change: V156A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144787
Gene: ENSMUSG00000025757
AA Change: V156A

DomainStartEndE-ValueType
Pfam:HSP70 3 570 6.2e-184 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203496
AA Change: V109A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145243
Gene: ENSMUSG00000025757
AA Change: V109A

DomainStartEndE-ValueType
Pfam:HSP70 3 58 5.4e-16 PFAM
Pfam:HSP70 54 158 9.3e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203904
SMART Domains Protein: ENSMUSP00000145405
Gene: ENSMUSG00000025757

DomainStartEndE-ValueType
Pfam:HSP70 3 125 6.1e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204702
AA Change: V156A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145468
Gene: ENSMUSG00000025757
AA Change: V156A

DomainStartEndE-ValueType
Pfam:HSP70 3 694 1.3e-192 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is heat shock inducible and may act as a chaperone. The encoded protein can protect the heat-shocked cell against the harmful effects of aggregated proteins. This gene is highly expressed in leukemia cells and may be a good target for therapeutic intervention. Several transcripts encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display increased incidence of male infertility, due to reduced number of mature sperm and reduced sperm motility, and hydronephrosis development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A T 6: 124,324,778 (GRCm39) L81H probably damaging Het
Abca8b A G 11: 109,868,667 (GRCm39) C166R probably damaging Het
Adgrv1 T A 13: 81,671,868 (GRCm39) E2242D probably damaging Het
Agap1 T C 1: 89,694,045 (GRCm39) S448P probably benign Het
Aldh1a2 T C 9: 71,160,334 (GRCm39) L120P probably damaging Het
Alkbh2 T C 5: 114,262,115 (GRCm39) N205S probably benign Het
Anapc1 C A 2: 128,511,608 (GRCm39) G493C possibly damaging Het
Aox3 A T 1: 58,192,220 (GRCm39) I497F possibly damaging Het
Atp2b1 T C 10: 98,850,354 (GRCm39) S826P possibly damaging Het
Atp8b4 T A 2: 126,164,928 (GRCm39) R1129S probably damaging Het
Bche T A 3: 73,609,159 (GRCm39) Q89L probably benign Het
Bche G T 3: 73,609,160 (GRCm39) Q89K probably benign Het
Bcl9 T C 3: 97,121,050 (GRCm39) K171E probably damaging Het
Cacna1b A T 2: 24,538,998 (GRCm39) Y1488N probably damaging Het
Dock8 A G 19: 25,098,545 (GRCm39) N623S probably null Het
Dok6 T C 18: 89,578,234 (GRCm39) E61G probably damaging Het
Duxf4 T A 10: 58,071,785 (GRCm39) Q143L possibly damaging Het
Esf1 A T 2: 139,990,806 (GRCm39) D559E possibly damaging Het
F11r A G 1: 171,289,438 (GRCm39) I254V probably benign Het
Fkrp A G 7: 16,545,802 (GRCm39) V20A probably benign Het
Fscb T C 12: 64,521,457 (GRCm39) E3G unknown Het
Hdlbp A G 1: 93,358,840 (GRCm39) I237T probably damaging Het
Hfm1 A T 5: 107,046,442 (GRCm39) D481E probably damaging Het
Igfn1 A G 1: 135,889,782 (GRCm39) S2422P probably benign Het
Il23r T A 6: 67,467,652 (GRCm39) probably null Het
Il24 G A 1: 130,810,268 (GRCm39) T196I probably benign Het
Isg15 T C 4: 156,284,250 (GRCm39) I93V probably benign Het
Kcna6 T C 6: 126,715,473 (GRCm39) E472G probably benign Het
Kif21b G A 1: 136,075,284 (GRCm39) D166N probably damaging Het
Lilrb4b A T 10: 51,357,831 (GRCm39) Q80L possibly damaging Het
Lrrc69 T C 4: 14,708,669 (GRCm39) E225G possibly damaging Het
Marchf6 A T 15: 31,469,792 (GRCm39) L726Q probably damaging Het
Megf6 G T 4: 154,352,124 (GRCm39) G1210C probably damaging Het
Msh2 C T 17: 88,026,724 (GRCm39) T740I probably damaging Het
Myh14 T C 7: 44,288,446 (GRCm39) Y514C probably damaging Het
Myorg C A 4: 41,497,501 (GRCm39) A710S possibly damaging Het
Nedd1 T C 10: 92,550,022 (GRCm39) T88A possibly damaging Het
Nfkb1 G A 3: 135,321,110 (GRCm39) T215I possibly damaging Het
Obox1 A T 7: 15,289,135 (GRCm39) I17L probably benign Het
Or11g24 A T 14: 50,662,848 (GRCm39) I291L possibly damaging Het
Palb2 A C 7: 121,726,303 (GRCm39) H522Q probably damaging Het
Pde4c C T 8: 71,177,191 (GRCm39) T6M probably damaging Het
Plekhg1 A G 10: 3,908,181 (GRCm39) K97E probably damaging Het
Plod3 A G 5: 137,019,707 (GRCm39) probably null Het
Plppr3 A T 10: 79,703,294 (GRCm39) Y63* probably null Het
Pwwp4a G T X: 72,171,261 (GRCm39) G218C probably damaging Het
Qrich1 T C 9: 108,411,246 (GRCm39) V257A probably damaging Het
Rpl14 A G 9: 120,401,253 (GRCm39) D32G possibly damaging Het
Senp8 A G 9: 59,644,721 (GRCm39) V132A possibly damaging Het
Serac1 A G 17: 6,095,964 (GRCm39) probably null Het
Sh2d3c T A 2: 32,639,256 (GRCm39) C295* probably null Het
Stab1 A G 14: 30,872,605 (GRCm39) F1142L probably benign Het
Stam2 T C 2: 52,599,638 (GRCm39) T257A possibly damaging Het
Tedc2 T A 17: 24,435,291 (GRCm39) E366V probably damaging Het
Tedc2 C A 17: 24,435,292 (GRCm39) E366* probably null Het
Tg A G 15: 66,554,691 (GRCm39) E702G probably benign Het
Tgif2lx2 A T X: 117,337,690 (GRCm39) K218* probably null Het
Tpp1 C A 7: 105,400,905 (GRCm39) V41L probably benign Het
Tulp3 A T 6: 128,303,769 (GRCm39) S277T probably benign Het
Zfp407 C T 18: 84,577,898 (GRCm39) A1072T probably benign Het
Zfp683 T C 4: 133,784,766 (GRCm39) F338L probably damaging Het
Other mutations in Hspa4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02466:Hspa4l APN 3 40,707,657 (GRCm39) nonsense probably null
IGL02605:Hspa4l APN 3 40,736,055 (GRCm39) missense probably benign 0.20
IGL02719:Hspa4l APN 3 40,727,090 (GRCm39) missense possibly damaging 0.60
R0281:Hspa4l UTSW 3 40,739,840 (GRCm39) splice site probably benign
R0398:Hspa4l UTSW 3 40,711,429 (GRCm39) splice site probably benign
R0487:Hspa4l UTSW 3 40,738,758 (GRCm39) missense possibly damaging 0.87
R0610:Hspa4l UTSW 3 40,733,832 (GRCm39) missense probably benign 0.01
R0760:Hspa4l UTSW 3 40,739,155 (GRCm39) nonsense probably null
R1491:Hspa4l UTSW 3 40,741,226 (GRCm39) missense probably benign 0.00
R1720:Hspa4l UTSW 3 40,736,049 (GRCm39) nonsense probably null
R1986:Hspa4l UTSW 3 40,714,833 (GRCm39) missense probably damaging 1.00
R2100:Hspa4l UTSW 3 40,727,090 (GRCm39) missense possibly damaging 0.60
R3706:Hspa4l UTSW 3 40,736,125 (GRCm39) missense possibly damaging 0.55
R3708:Hspa4l UTSW 3 40,736,125 (GRCm39) missense possibly damaging 0.55
R3856:Hspa4l UTSW 3 40,739,821 (GRCm39) missense probably benign 0.29
R3874:Hspa4l UTSW 3 40,727,074 (GRCm39) missense probably damaging 1.00
R3890:Hspa4l UTSW 3 40,736,026 (GRCm39) missense possibly damaging 0.90
R4256:Hspa4l UTSW 3 40,700,435 (GRCm39) missense probably benign 0.03
R4364:Hspa4l UTSW 3 40,721,241 (GRCm39) splice site probably null
R4365:Hspa4l UTSW 3 40,721,241 (GRCm39) splice site probably null
R4366:Hspa4l UTSW 3 40,721,241 (GRCm39) splice site probably null
R4493:Hspa4l UTSW 3 40,722,434 (GRCm39) missense possibly damaging 0.77
R4494:Hspa4l UTSW 3 40,707,636 (GRCm39) missense possibly damaging 0.86
R4954:Hspa4l UTSW 3 40,739,832 (GRCm39) critical splice donor site probably null
R4994:Hspa4l UTSW 3 40,700,081 (GRCm39) utr 5 prime probably benign
R5114:Hspa4l UTSW 3 40,700,197 (GRCm39) missense possibly damaging 0.60
R5133:Hspa4l UTSW 3 40,741,179 (GRCm39) missense possibly damaging 0.94
R5202:Hspa4l UTSW 3 40,736,001 (GRCm39) missense probably benign 0.17
R5440:Hspa4l UTSW 3 40,736,008 (GRCm39) missense probably damaging 1.00
R5635:Hspa4l UTSW 3 40,700,177 (GRCm39) missense probably damaging 1.00
R5997:Hspa4l UTSW 3 40,722,411 (GRCm39) missense probably damaging 0.99
R6012:Hspa4l UTSW 3 40,736,031 (GRCm39) missense probably benign 0.09
R6515:Hspa4l UTSW 3 40,736,014 (GRCm39) missense possibly damaging 0.82
R6589:Hspa4l UTSW 3 40,711,487 (GRCm39) missense probably damaging 0.99
R7091:Hspa4l UTSW 3 40,736,024 (GRCm39) missense probably benign 0.00
R7601:Hspa4l UTSW 3 40,738,788 (GRCm39) critical splice donor site probably null
R8072:Hspa4l UTSW 3 40,741,178 (GRCm39) missense probably damaging 0.98
R9103:Hspa4l UTSW 3 40,715,349 (GRCm39) critical splice donor site probably null
R9146:Hspa4l UTSW 3 40,736,101 (GRCm39) missense probably benign 0.15
R9762:Hspa4l UTSW 3 40,727,057 (GRCm39) missense probably benign 0.01
Z1088:Hspa4l UTSW 3 40,721,425 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCAAATCCAGTCTGCATGG -3'
(R):5'- GACTCATCTGAAAAGTTACAGCAG -3'

Sequencing Primer
(F):5'- TCTGCATGGCGTAGAAAGTATCC -3'
(R):5'- AGCAGTAACGGCTCTTCAAGTTC -3'
Posted On 2014-08-25