Incidental Mutation 'R1984:Bche'
ID220284
Institutional Source Beutler Lab
Gene Symbol Bche
Ensembl Gene ENSMUSG00000027792
Gene Namebutyrylcholinesterase
SynonymsC730038G20Rik
MMRRC Submission 039996-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1984 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location73635808-73708415 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73701826 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 89 (Q89L)
Ref Sequence ENSEMBL: ENSMUSP00000141329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029367] [ENSMUST00000138216]
Predicted Effect probably benign
Transcript: ENSMUST00000029367
AA Change: Q89L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000029367
Gene: ENSMUSG00000027792
AA Change: Q89L

DomainStartEndE-ValueType
Pfam:COesterase 10 551 5.2e-183 PFAM
Pfam:Abhydrolase_3 139 242 1.9e-7 PFAM
Pfam:AChE_tetra 566 602 8.6e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133690
Predicted Effect probably benign
Transcript: ENSMUST00000138216
AA Change: Q89L

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000141329
Gene: ENSMUSG00000027792
AA Change: Q89L

DomainStartEndE-ValueType
Pfam:COesterase 10 174 6.9e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153917
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cholinesterase enzyme and member of the type-B carboxylesterase/lipase family of proteins. The encoded enzyme exhibits broad substrate specificity and is involved in the detoxification of poisons including organophosphate nerve agents and pesticides, and the metabolism of drugs including cocaine, heroin and aspirin. Humans homozygous for certain mutations in this gene exhibit prolonged apnea after administration of the muscle relaxant succinylcholine. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation do not exhibit any overt abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A T 6: 124,347,819 L81H probably damaging Het
Abca8b A G 11: 109,977,841 C166R probably damaging Het
Adgrv1 T A 13: 81,523,749 E2242D probably damaging Het
Agap1 T C 1: 89,766,323 S448P probably benign Het
AI464131 C A 4: 41,497,501 A710S possibly damaging Het
Aldh1a2 T C 9: 71,253,052 L120P probably damaging Het
Alkbh2 T C 5: 114,124,054 N205S probably benign Het
Anapc1 C A 2: 128,669,688 G493C possibly damaging Het
Aox3 A T 1: 58,153,061 I497F possibly damaging Het
Atp2b1 T C 10: 99,014,492 S826P possibly damaging Het
Atp8b4 T A 2: 126,323,008 R1129S probably damaging Het
Bcl9 T C 3: 97,213,734 K171E probably damaging Het
Cacna1b A T 2: 24,648,986 Y1488N probably damaging Het
Dock8 A G 19: 25,121,181 N623S probably null Het
Dok6 T C 18: 89,560,110 E61G probably damaging Het
Esf1 A T 2: 140,148,886 D559E possibly damaging Het
F11r A G 1: 171,461,870 I254V probably benign Het
Fkrp A G 7: 16,811,877 V20A probably benign Het
Fscb T C 12: 64,474,683 E3G unknown Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm4981 T A 10: 58,235,963 Q143L possibly damaging Het
Hdlbp A G 1: 93,431,118 I237T probably damaging Het
Hfm1 A T 5: 106,898,576 D481E probably damaging Het
Hspa4l T C 3: 40,760,401 V156A probably damaging Het
Igfn1 A G 1: 135,962,044 S2422P probably benign Het
Il23r T A 6: 67,490,668 probably null Het
Il24 G A 1: 130,882,531 T196I probably benign Het
Isg15 T C 4: 156,199,793 I93V probably benign Het
Kcna6 T C 6: 126,738,510 E472G probably benign Het
Kif21b G A 1: 136,147,546 D166N probably damaging Het
Lilr4b A T 10: 51,481,735 Q80L possibly damaging Het
Lrrc69 T C 4: 14,708,669 E225G possibly damaging Het
March6 A T 15: 31,469,646 L726Q probably damaging Het
Megf6 G T 4: 154,267,667 G1210C probably damaging Het
Msh2 C T 17: 87,719,296 T740I probably damaging Het
Myh14 T C 7: 44,639,022 Y514C probably damaging Het
Nedd1 T C 10: 92,714,160 T88A possibly damaging Het
Nfkb1 G A 3: 135,615,349 T215I possibly damaging Het
Obox1 A T 7: 15,555,210 I17L probably benign Het
Olfr739 A T 14: 50,425,391 I291L possibly damaging Het
Palb2 A C 7: 122,127,080 H522Q probably damaging Het
Pde4c C T 8: 70,724,542 T6M probably damaging Het
Plekhg1 A G 10: 3,958,181 K97E probably damaging Het
Plod3 A G 5: 136,990,853 probably null Het
Plppr3 A T 10: 79,867,460 Y63* probably null Het
Qrich1 T C 9: 108,534,047 V257A probably damaging Het
Rpl14 A G 9: 120,572,187 D32G possibly damaging Het
Senp8 A G 9: 59,737,438 V132A possibly damaging Het
Serac1 A G 17: 6,045,689 probably null Het
Sh2d3c T A 2: 32,749,244 C295* probably null Het
Stab1 A G 14: 31,150,648 F1142L probably benign Het
Stam2 T C 2: 52,709,626 T257A possibly damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tg A G 15: 66,682,842 E702G probably benign Het
Tgif2lx2 A T X: 118,427,993 K218* probably null Het
Tpp1 C A 7: 105,751,698 V41L probably benign Het
Tulp3 A T 6: 128,326,806 S277T probably benign Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp683 T C 4: 134,057,455 F338L probably damaging Het
Other mutations in Bche
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Bche APN 3 73701307 missense probably benign 0.00
IGL01420:Bche APN 3 73702009 missense probably benign 0.03
IGL02433:Bche APN 3 73701929 missense probably benign 0.02
IGL02734:Bche APN 3 73702076 missense probably benign 0.09
IGL03095:Bche APN 3 73701883 missense probably damaging 1.00
IGL03227:Bche APN 3 73701612 missense probably damaging 1.00
R0056:Bche UTSW 3 73701321 missense possibly damaging 0.79
R1780:Bche UTSW 3 73700620 missense probably benign 0.00
R1984:Bche UTSW 3 73701827 missense probably benign
R2403:Bche UTSW 3 73701472 missense probably damaging 0.96
R4989:Bche UTSW 3 73701844 missense probably benign 0.02
R5231:Bche UTSW 3 73700861 missense probably benign 0.07
R5363:Bche UTSW 3 73700639 missense probably damaging 0.98
R5987:Bche UTSW 3 73648678 missense possibly damaging 0.59
R6164:Bche UTSW 3 73701056 missense possibly damaging 0.63
R6381:Bche UTSW 3 73701799 missense probably benign 0.00
R6571:Bche UTSW 3 73701491 missense probably benign 0.08
R6801:Bche UTSW 3 73701800 missense probably benign
R6935:Bche UTSW 3 73701800 missense probably benign
R7275:Bche UTSW 3 73700636 missense probably benign 0.19
R7499:Bche UTSW 3 73701898 missense probably damaging 1.00
R7543:Bche UTSW 3 73701733 missense probably damaging 1.00
R7757:Bche UTSW 3 73701121 missense probably damaging 1.00
R7965:Bche UTSW 3 73701816 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTAGAGAAGAGGTCCCAGTTTG -3'
(R):5'- TGCATGCCTTTTGGGAAGTC -3'

Sequencing Primer
(F):5'- AGGTCCCAGTTTGAAAGCC -3'
(R):5'- CCTTTTGGGAAGTCACACACTGAAG -3'
Posted On2014-08-25