Incidental Mutation 'R1984:Megf6'
ID220298
Institutional Source Beutler Lab
Gene Symbol Megf6
Ensembl Gene ENSMUSG00000057751
Gene Namemultiple EGF-like-domains 6
Synonyms2600001P17Rik, Egfl3
MMRRC Submission 039996-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1984 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location154170730-154275713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 154267667 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 1210 (G1210C)
Ref Sequence ENSEMBL: ENSMUSP00000030897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030897] [ENSMUST00000152159]
Predicted Effect probably damaging
Transcript: ENSMUST00000030897
AA Change: G1210C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030897
Gene: ENSMUSG00000057751
AA Change: G1210C

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
EGF_CA 122 162 1.54e-6 SMART
EGF_CA 163 203 2.08e-12 SMART
EGF 207 245 5.4e-2 SMART
EGF 249 286 2.39e-3 SMART
EGF_CA 287 327 4.96e-10 SMART
EGF 336 373 1.64e-1 SMART
EGF 377 413 1.99e1 SMART
EGF_CA 414 454 7.4e-9 SMART
EGF 521 554 4.26e0 SMART
EGF_Lam 570 609 1.19e-3 SMART
EGF_like 613 652 5.29e-1 SMART
EGF 642 685 2.2e1 SMART
EGF_Lam 656 697 1.04e-3 SMART
EGF 687 730 1.59e1 SMART
EGF_like 701 742 2.27e0 SMART
EGF_Lam 746 784 1.33e-1 SMART
EGF 783 816 2.85e-1 SMART
EGF_Lam 832 871 3.88e-3 SMART
EGF_Lam 875 915 3.25e-5 SMART
EGF 914 946 4.7e-2 SMART
EGF_like 962 1001 1.69e-1 SMART
EGF 1000 1032 7.02e-1 SMART
EGF_Lam 1048 1087 3.1e-2 SMART
EGF 1077 1118 7.53e-1 SMART
EGF_like 1091 1130 5.59e-1 SMART
EGF 1129 1161 5.04e-2 SMART
EGF_Lam 1177 1216 2.94e-3 SMART
EGF 1206 1248 1.87e1 SMART
EGF_Lam 1220 1260 3.1e-2 SMART
EGF 1259 1291 1.73e0 SMART
EGF 1302 1334 6.55e-1 SMART
EGF 1345 1377 4.39e-2 SMART
EGF_Lam 1393 1432 7.64e-2 SMART
EGF_Lam 1436 1475 2.64e-5 SMART
EGF_like 1465 1506 4.2e1 SMART
EGF_Lam 1479 1518 1.19e-3 SMART
EGF 1517 1549 1.84e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127088
Predicted Effect probably benign
Transcript: ENSMUST00000128700
SMART Domains Protein: ENSMUSP00000117277
Gene: ENSMUSG00000057751

DomainStartEndE-ValueType
EGF_Lam 3 42 3.1e-2 SMART
EGF 32 73 7.53e-1 SMART
EGF_like 46 85 8.92e-1 SMART
EGF 84 116 7.13e-2 SMART
EGF 127 159 1.73e0 SMART
EGF 170 202 6.55e-1 SMART
EGF 213 245 4.39e-2 SMART
EGF_Lam 261 300 7.64e-2 SMART
EGF 299 331 1.51e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142110
Predicted Effect probably benign
Transcript: ENSMUST00000152159
SMART Domains Protein: ENSMUSP00000121641
Gene: ENSMUSG00000057751

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF_CA 55 95 2.08e-12 SMART
EGF 99 137 5.4e-2 SMART
EGF 141 178 2.39e-3 SMART
EGF_CA 179 219 4.96e-10 SMART
EGF 228 265 1.64e-1 SMART
EGF 269 305 1.99e1 SMART
EGF_CA 306 346 7.4e-9 SMART
EGF 413 446 4.26e0 SMART
EGF_Lam 462 501 1.19e-3 SMART
EGF_like 505 544 5.29e-1 SMART
EGF 534 577 2.2e1 SMART
EGF_Lam 548 589 1.04e-3 SMART
EGF 579 622 1.59e1 SMART
EGF_like 593 634 2.27e0 SMART
EGF_Lam 638 676 1.33e-1 SMART
EGF 675 708 2.85e-1 SMART
EGF_Lam 724 763 3.88e-3 SMART
EGF_Lam 767 807 3.25e-5 SMART
EGF 806 838 4.7e-2 SMART
EGF_Lam 854 893 2.56e-3 SMART
EGF 892 924 2.02e-1 SMART
EGF 935 967 7.13e-2 SMART
EGF 978 1010 1.73e0 SMART
EGF 1021 1053 6.55e-1 SMART
EGF 1064 1096 4.39e-2 SMART
EGF 1107 1139 4.97e-1 SMART
EGF 1159 1191 1.84e1 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A T 6: 124,347,819 L81H probably damaging Het
Abca8b A G 11: 109,977,841 C166R probably damaging Het
Adgrv1 T A 13: 81,523,749 E2242D probably damaging Het
Agap1 T C 1: 89,766,323 S448P probably benign Het
AI464131 C A 4: 41,497,501 A710S possibly damaging Het
Aldh1a2 T C 9: 71,253,052 L120P probably damaging Het
Alkbh2 T C 5: 114,124,054 N205S probably benign Het
Anapc1 C A 2: 128,669,688 G493C possibly damaging Het
Aox3 A T 1: 58,153,061 I497F possibly damaging Het
Atp2b1 T C 10: 99,014,492 S826P possibly damaging Het
Atp8b4 T A 2: 126,323,008 R1129S probably damaging Het
Bche T A 3: 73,701,826 Q89L probably benign Het
Bche G T 3: 73,701,827 Q89K probably benign Het
Bcl9 T C 3: 97,213,734 K171E probably damaging Het
Cacna1b A T 2: 24,648,986 Y1488N probably damaging Het
Dock8 A G 19: 25,121,181 N623S probably null Het
Dok6 T C 18: 89,560,110 E61G probably damaging Het
Esf1 A T 2: 140,148,886 D559E possibly damaging Het
F11r A G 1: 171,461,870 I254V probably benign Het
Fkrp A G 7: 16,811,877 V20A probably benign Het
Fscb T C 12: 64,474,683 E3G unknown Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm4981 T A 10: 58,235,963 Q143L possibly damaging Het
Hdlbp A G 1: 93,431,118 I237T probably damaging Het
Hfm1 A T 5: 106,898,576 D481E probably damaging Het
Hspa4l T C 3: 40,760,401 V156A probably damaging Het
Igfn1 A G 1: 135,962,044 S2422P probably benign Het
Il23r T A 6: 67,490,668 probably null Het
Il24 G A 1: 130,882,531 T196I probably benign Het
Isg15 T C 4: 156,199,793 I93V probably benign Het
Kcna6 T C 6: 126,738,510 E472G probably benign Het
Kif21b G A 1: 136,147,546 D166N probably damaging Het
Lilr4b A T 10: 51,481,735 Q80L possibly damaging Het
Lrrc69 T C 4: 14,708,669 E225G possibly damaging Het
March6 A T 15: 31,469,646 L726Q probably damaging Het
Msh2 C T 17: 87,719,296 T740I probably damaging Het
Myh14 T C 7: 44,639,022 Y514C probably damaging Het
Nedd1 T C 10: 92,714,160 T88A possibly damaging Het
Nfkb1 G A 3: 135,615,349 T215I possibly damaging Het
Obox1 A T 7: 15,555,210 I17L probably benign Het
Olfr739 A T 14: 50,425,391 I291L possibly damaging Het
Palb2 A C 7: 122,127,080 H522Q probably damaging Het
Pde4c C T 8: 70,724,542 T6M probably damaging Het
Plekhg1 A G 10: 3,958,181 K97E probably damaging Het
Plod3 A G 5: 136,990,853 probably null Het
Plppr3 A T 10: 79,867,460 Y63* probably null Het
Qrich1 T C 9: 108,534,047 V257A probably damaging Het
Rpl14 A G 9: 120,572,187 D32G possibly damaging Het
Senp8 A G 9: 59,737,438 V132A possibly damaging Het
Serac1 A G 17: 6,045,689 probably null Het
Sh2d3c T A 2: 32,749,244 C295* probably null Het
Stab1 A G 14: 31,150,648 F1142L probably benign Het
Stam2 T C 2: 52,709,626 T257A possibly damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tg A G 15: 66,682,842 E702G probably benign Het
Tgif2lx2 A T X: 118,427,993 K218* probably null Het
Tpp1 C A 7: 105,751,698 V41L probably benign Het
Tulp3 A T 6: 128,326,806 S277T probably benign Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp683 T C 4: 134,057,455 F338L probably damaging Het
Other mutations in Megf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Megf6 APN 4 154253807 missense probably damaging 1.00
IGL01410:Megf6 APN 4 154252563 critical splice donor site probably null
IGL01512:Megf6 APN 4 154262583 missense possibly damaging 0.64
IGL01824:Megf6 APN 4 154252234 missense probably damaging 1.00
IGL02172:Megf6 APN 4 154270692 missense probably damaging 1.00
IGL02727:Megf6 APN 4 154253149 splice site probably null
IGL02966:Megf6 APN 4 154253777 missense probably damaging 1.00
Didactic UTSW 4 154254587 missense probably damaging 1.00
R0118:Megf6 UTSW 4 154254641 missense probably damaging 0.99
R0220:Megf6 UTSW 4 154258215 missense probably damaging 1.00
R0347:Megf6 UTSW 4 154254635 missense possibly damaging 0.90
R0383:Megf6 UTSW 4 154265326 missense probably benign 0.01
R0417:Megf6 UTSW 4 154267967 missense probably benign 0.06
R0526:Megf6 UTSW 4 154258941 missense probably benign
R0528:Megf6 UTSW 4 154259173 missense probably benign 0.04
R0928:Megf6 UTSW 4 154177047 missense probably damaging 1.00
R1311:Megf6 UTSW 4 154263782 splice site probably null
R1458:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1470:Megf6 UTSW 4 154252419 splice site probably benign
R1476:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1479:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1624:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1626:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1638:Megf6 UTSW 4 154262510 splice site probably benign
R1777:Megf6 UTSW 4 154270690 nonsense probably null
R1831:Megf6 UTSW 4 154270677 missense probably benign 0.00
R1944:Megf6 UTSW 4 154256066 missense possibly damaging 0.75
R2109:Megf6 UTSW 4 154177121 missense probably benign 0.39
R2448:Megf6 UTSW 4 154266645 intron probably null
R2880:Megf6 UTSW 4 154252549 missense probably damaging 1.00
R4032:Megf6 UTSW 4 154177093 nonsense probably null
R4058:Megf6 UTSW 4 154242532 splice site probably benign
R4672:Megf6 UTSW 4 154249452 missense probably damaging 0.99
R4688:Megf6 UTSW 4 154253814 missense probably damaging 0.99
R4752:Megf6 UTSW 4 154252438 missense probably damaging 1.00
R4863:Megf6 UTSW 4 154254281 critical splice donor site probably null
R4909:Megf6 UTSW 4 154265391 missense probably damaging 1.00
R4942:Megf6 UTSW 4 154253820 missense probably damaging 1.00
R4981:Megf6 UTSW 4 154267450 missense possibly damaging 0.95
R4990:Megf6 UTSW 4 154267226 missense possibly damaging 0.94
R5001:Megf6 UTSW 4 154268060 missense probably damaging 1.00
R5189:Megf6 UTSW 4 154252523 missense probably benign 0.31
R5210:Megf6 UTSW 4 154269816 intron probably benign
R5220:Megf6 UTSW 4 154253838 critical splice donor site probably null
R5250:Megf6 UTSW 4 154256010 missense possibly damaging 0.65
R5697:Megf6 UTSW 4 154258229 missense probably null 0.15
R5808:Megf6 UTSW 4 154267662 missense probably benign
R5916:Megf6 UTSW 4 154249425 critical splice acceptor site probably null
R6054:Megf6 UTSW 4 154263179 missense probably benign 0.06
R6075:Megf6 UTSW 4 154262599 nonsense probably null
R6515:Megf6 UTSW 4 154258919 missense possibly damaging 0.84
R6599:Megf6 UTSW 4 154258087 splice site probably null
R6811:Megf6 UTSW 4 154252161 missense probably damaging 1.00
R6925:Megf6 UTSW 4 154254587 missense probably damaging 1.00
R7023:Megf6 UTSW 4 154254145 missense possibly damaging 0.95
R7117:Megf6 UTSW 4 154258922 missense possibly damaging 0.78
R7163:Megf6 UTSW 4 154267441 missense probably damaging 0.98
R7345:Megf6 UTSW 4 154267315 missense probably benign
R7580:Megf6 UTSW 4 154270744 nonsense probably null
R7649:Megf6 UTSW 4 154265085 missense probably damaging 0.96
R7702:Megf6 UTSW 4 154270470 missense probably benign 0.00
R8010:Megf6 UTSW 4 154270507 missense probably benign 0.13
Z1177:Megf6 UTSW 4 154237826 missense probably benign 0.12
Z1177:Megf6 UTSW 4 154250849 missense probably damaging 1.00
Z1177:Megf6 UTSW 4 154267681 missense possibly damaging 0.48
Z1177:Megf6 UTSW 4 154267682 missense probably damaging 0.99
Z1177:Megf6 UTSW 4 154267747 nonsense probably null
Z1177:Megf6 UTSW 4 154269741 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCGTTCCCAGAAAGCTTACC -3'
(R):5'- ACCTTACATACCAGAATGGCAG -3'

Sequencing Primer
(F):5'- TGCTCAGCGTTGCCACTG -3'
(R):5'- TTACATACCAGAATGGCAGACAGAAC -3'
Posted On2014-08-25