Incidental Mutation 'R0137:Rccd1'
ID22032
Institutional Source Beutler Lab
Gene Symbol Rccd1
Ensembl Gene ENSMUSG00000038930
Gene NameRCC1 domain containing 1
Synonyms
MMRRC Submission 038422-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0137 (G1)
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location80293229-80324454 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80320578 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 97 (V97A)
Ref Sequence ENSEMBL: ENSMUSP00000113273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032748] [ENSMUST00000047362] [ENSMUST00000047558] [ENSMUST00000107368] [ENSMUST00000121882] [ENSMUST00000123189] [ENSMUST00000154428] [ENSMUST00000163812] [ENSMUST00000173824] [ENSMUST00000174172] [ENSMUST00000174199]
Predicted Effect probably benign
Transcript: ENSMUST00000032748
SMART Domains Protein: ENSMUSP00000032748
Gene: ENSMUSG00000030533

DomainStartEndE-ValueType
TPR 21 54 9.53e-2 SMART
TPR 58 91 5.48e-2 SMART
TPR 92 125 7.45e-4 SMART
Blast:ARM 183 224 6e-9 BLAST
Blast:ARM 226 266 1e-7 BLAST
Pfam:UNC45-central 287 505 1.2e-43 PFAM
Blast:ARM 679 717 4e-13 BLAST
Blast:ARM 720 762 4e-12 BLAST
Blast:ARM 764 804 8e-16 BLAST
low complexity region 833 845 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000047362
AA Change: V97A

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000048043
Gene: ENSMUSG00000038930
AA Change: V97A

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
Pfam:RCC1 179 228 2.9e-17 PFAM
Pfam:RCC1_2 215 244 1.3e-10 PFAM
Pfam:RCC1 231 316 7.8e-9 PFAM
Pfam:RCC1_2 303 332 3.3e-10 PFAM
Pfam:RCC1 319 370 4.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047558
SMART Domains Protein: ENSMUSP00000043379
Gene: ENSMUSG00000038943

DomainStartEndE-ValueType
internal_repeat_1 22 36 1.45e-5 PROSPERO
Pfam:MAP65_ASE1 37 602 5.3e-172 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107368
SMART Domains Protein: ENSMUSP00000102991
Gene: ENSMUSG00000030533

DomainStartEndE-ValueType
TPR 21 54 9.53e-2 SMART
TPR 58 91 5.48e-2 SMART
TPR 92 125 7.45e-4 SMART
Blast:ARM 183 224 6e-9 BLAST
Blast:ARM 226 266 1e-7 BLAST
Pfam:UNC45-central 314 505 2.4e-38 PFAM
Blast:ARM 679 717 4e-13 BLAST
Blast:ARM 720 762 4e-12 BLAST
Blast:ARM 764 804 8e-16 BLAST
low complexity region 833 845 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121882
AA Change: V97A

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113273
Gene: ENSMUSG00000038930
AA Change: V97A

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
Pfam:RCC1 179 228 7.4e-18 PFAM
Pfam:RCC1_2 216 244 5.5e-10 PFAM
Pfam:RCC1_2 304 332 6.2e-10 PFAM
Pfam:RCC1 319 370 1.3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123109
Predicted Effect probably benign
Transcript: ENSMUST00000123189
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144685
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148001
Predicted Effect probably benign
Transcript: ENSMUST00000154428
SMART Domains Protein: ENSMUSP00000119665
Gene: ENSMUSG00000030533

DomainStartEndE-ValueType
TPR 21 54 9.53e-2 SMART
TPR 58 91 5.48e-2 SMART
TPR 92 125 7.45e-4 SMART
Blast:ARM 183 224 4e-9 BLAST
Blast:ARM 226 266 6e-8 BLAST
Pfam:UNC45-central 287 505 3.5e-44 PFAM
low complexity region 597 608 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155124
Predicted Effect probably benign
Transcript: ENSMUST00000163812
SMART Domains Protein: ENSMUSP00000129675
Gene: ENSMUSG00000038943

DomainStartEndE-ValueType
internal_repeat_1 22 36 1.51e-5 PROSPERO
Pfam:MAP65_ASE1 37 605 1.9e-173 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173824
SMART Domains Protein: ENSMUSP00000133910
Gene: ENSMUSG00000038943

DomainStartEndE-ValueType
internal_repeat_1 22 36 8.71e-6 PROSPERO
Pfam:MAP65_ASE1 37 565 6e-168 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174051
SMART Domains Protein: ENSMUSP00000134262
Gene: ENSMUSG00000038943

DomainStartEndE-ValueType
Pfam:MAP65_ASE1 1 244 1.9e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174172
SMART Domains Protein: ENSMUSP00000133387
Gene: ENSMUSG00000038943

DomainStartEndE-ValueType
Pfam:MAP65_ASE1 34 615 2.9e-167 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174199
SMART Domains Protein: ENSMUSP00000133295
Gene: ENSMUSG00000038943

DomainStartEndE-ValueType
Pfam:MAP65_ASE1 7 524 8.1e-158 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205863
Predicted Effect probably benign
Transcript: ENSMUST00000206363
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.8%
Validation Efficiency 95% (94/99)
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700092M07Rik A G 19: 8,740,857 probably benign Het
4931406P16Rik A T 7: 34,239,219 W246R probably damaging Het
6430548M08Rik A T 8: 120,151,376 H190L possibly damaging Het
Adap1 A G 5: 139,293,221 probably benign Het
Adgra3 C T 5: 49,963,840 probably benign Het
Adgre5 A T 8: 83,724,898 V527E probably damaging Het
Anapc5 A T 5: 122,800,632 Y360N probably damaging Het
Angptl6 C A 9: 20,878,387 A70S probably benign Het
Ankdd1a C A 9: 65,510,328 K137N probably null Het
Ccdc170 T C 10: 4,546,950 probably benign Het
Ccdc51 A G 9: 109,091,630 E195G probably damaging Het
Cdc37 A T 9: 21,142,130 C204S possibly damaging Het
Cfap36 T C 11: 29,222,431 probably benign Het
Col6a2 C A 10: 76,596,425 G965C probably damaging Het
Csn1s2a G A 5: 87,778,967 S53N possibly damaging Het
Dab2ip T C 2: 35,692,376 probably null Het
Dhx58 A G 11: 100,696,997 V578A probably damaging Het
Diaph1 G T 18: 37,891,849 Q520K unknown Het
Eefsec C A 6: 88,297,649 K444N probably benign Het
Eftud2 A T 11: 102,868,617 H153Q possibly damaging Het
Eif5b T G 1: 38,019,243 S209A probably benign Het
Exosc2 T A 2: 31,672,485 Y46N probably damaging Het
F2 C T 2: 91,625,730 G562D probably damaging Het
Fgf23 G A 6: 127,080,165 G148D probably damaging Het
Fmnl3 G C 15: 99,322,738 probably benign Het
Fstl5 G A 3: 76,707,479 G179R probably damaging Het
Gart T A 16: 91,625,394 Q745L probably benign Het
Gmeb1 T A 4: 132,232,108 M212L probably benign Het
Gpaa1 T C 15: 76,334,781 Y548H probably damaging Het
Gpatch1 T C 7: 35,287,242 E763G probably damaging Het
Grm8 T A 6: 27,762,390 I279F probably damaging Het
Hcls1 T A 16: 36,951,174 H147Q probably damaging Het
Hpcal1 A C 12: 17,786,388 D73A probably damaging Het
Il22ra1 T C 4: 135,751,006 S463P probably benign Het
Itgbl1 G A 14: 123,840,686 probably null Het
Izumo3 G T 4: 92,147,200 probably benign Het
Kcna5 A T 6: 126,533,383 L594Q probably damaging Het
Kif13a A T 13: 46,764,603 D409E probably benign Het
Kif9 A T 9: 110,485,038 I39F probably damaging Het
Klri2 C T 6: 129,732,208 R227H possibly damaging Het
Lamc3 G A 2: 31,908,616 G445S probably damaging Het
Lctl A G 9: 64,117,698 probably benign Het
Lrp4 T C 2: 91,494,982 L1384P probably damaging Het
Mcm9 G A 10: 53,563,430 S549L possibly damaging Het
Ms4a15 G A 19: 10,979,333 probably benign Het
Mtor T C 4: 148,470,624 V901A possibly damaging Het
Nckap1l A T 15: 103,481,964 I721F probably benign Het
Nemp2 T C 1: 52,645,429 V298A probably benign Het
Npc1l1 T A 11: 6,228,148 K421* probably null Het
Npr1 C T 3: 90,455,937 V879M probably damaging Het
Olfr1368 A G 13: 21,142,166 V297A possibly damaging Het
Olfr638 A G 7: 104,003,502 T82A probably benign Het
Osgin1 A T 8: 119,442,480 I39F possibly damaging Het
Phip G C 9: 82,927,191 probably null Het
Pkdrej G T 15: 85,821,567 P56Q possibly damaging Het
Plcxd2 A G 16: 45,980,526 Y112H probably damaging Het
Plekha1 C T 7: 130,897,446 T155M probably damaging Het
Prkdc T C 16: 15,740,332 probably null Het
Prss1 A G 6: 41,462,561 H76R probably damaging Het
Psg23 T C 7: 18,614,633 D83G probably benign Het
Ptprd T A 4: 76,136,903 Q196L probably benign Het
Ranbp3l A T 15: 9,062,987 H292L probably damaging Het
Ranbp6 T C 19: 29,809,697 E1085G probably benign Het
Rchy1 T C 5: 91,957,599 S48G probably benign Het
Rnmt G A 18: 68,313,700 M265I probably benign Het
Robo3 A T 9: 37,425,344 M376K probably benign Het
Rrp12 T C 19: 41,873,850 D898G probably benign Het
Scg3 A T 9: 75,663,180 probably benign Het
Sec31b A T 19: 44,534,382 M57K probably damaging Het
Slc17a6 A C 7: 51,666,144 I387L probably benign Het
Speer4a T A 5: 26,035,984 Q170L possibly damaging Het
Srsf9 A G 5: 115,332,201 D146G possibly damaging Het
Ss18 A G 18: 14,655,143 M90T probably damaging Het
Syna A T 5: 134,559,460 F212I possibly damaging Het
Thsd1 A G 8: 22,243,039 H34R probably damaging Het
Tmem143 T C 7: 45,897,662 I84T probably benign Het
Trim50 T C 5: 135,366,633 V281A probably damaging Het
Trp53i11 C A 2: 93,199,351 probably benign Het
Ttc25 A G 11: 100,563,568 E393G probably damaging Het
Ttll4 C T 1: 74,679,692 T234I possibly damaging Het
Ttyh1 A T 7: 4,124,720 I136F possibly damaging Het
Ube2f T C 1: 91,262,254 probably benign Het
Vcl T A 14: 20,987,015 L227* probably null Het
Vmn1r222 A C 13: 23,232,804 C80G probably damaging Het
Vps13b G T 15: 35,926,219 A3889S probably benign Het
Vps8 T C 16: 21,504,386 probably benign Het
Zbtb44 A G 9: 31,066,710 Y422C probably damaging Het
Zfp180 A G 7: 24,105,733 S526G possibly damaging Het
Zfp518a A C 19: 40,915,866 E1413A probably damaging Het
Zfp629 T A 7: 127,611,686 Y317F probably damaging Het
Zfp804b T C 5: 6,770,534 E843G probably benign Het
Other mutations in Rccd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01915:Rccd1 APN 7 80320218 unclassified probably benign
IGL02024:Rccd1 APN 7 80319007 missense probably benign 0.00
IGL02747:Rccd1 APN 7 80320490 missense probably benign 0.31
IGL02936:Rccd1 APN 7 80317046 missense probably damaging 0.97
K3955:Rccd1 UTSW 7 80320671 missense probably benign 0.04
R0671:Rccd1 UTSW 7 80320217 unclassified probably benign
R0909:Rccd1 UTSW 7 80319051 intron probably null
R1588:Rccd1 UTSW 7 80320111 nonsense probably null
R1706:Rccd1 UTSW 7 80320663 missense possibly damaging 0.79
R1826:Rccd1 UTSW 7 80320218 unclassified probably benign
R1934:Rccd1 UTSW 7 80320524 missense possibly damaging 0.64
R2983:Rccd1 UTSW 7 80320528 nonsense probably null
R3861:Rccd1 UTSW 7 80320368 missense probably benign 0.00
R7387:Rccd1 UTSW 7 80320602 missense probably benign 0.26
X0022:Rccd1 UTSW 7 80320567 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- ATCCAAGAGAGCCTCTCCTTGAGC -3'
(R):5'- CAGCCACCATTCAGTGTACAGTCC -3'

Sequencing Primer
(F):5'- GCAGCACATGCTCAGCTC -3'
(R):5'- CATGCCAGTGATGATATTTGCC -3'
Posted On2013-04-12