Mutagenetix > Incidental Mutations

Incidental Mutation 'R2024:Chd8'

220334

Institutional Source

Beutler Lab

Gene Symbol

Chd8

Ensembl Gene

ENSMUSG00000053754

Gene Name

chromodomain helicase DNA binding protein 8

Synonyms

Duplin, 5830451P18Rik

MMRRC Submission

040033-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2024 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

52198151-52257780 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 52231493 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 556 (D556G)

Ref Sequence

ENSEMBL: ENSMUSP00000142890 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089752] [ENSMUST00000149975] [ENSMUST00000200169]

AlphaFold

Q09XV5

Predicted Effect

probably benign
Transcript: ENSMUST00000089752
AA Change: D556G

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000087184
Gene: ENSMUSG00000053754
AA Change: D556G

Domain	Start	End	E-Value	Type
low complexity region	255	272	N/A	INTRINSIC
low complexity region	340	374	N/A	INTRINSIC
low complexity region	404	437	N/A	INTRINSIC
low complexity region	463	477	N/A	INTRINSIC
low complexity region	497	534	N/A	INTRINSIC
low complexity region	588	607	N/A	INTRINSIC
CHROMO	642	708	1.8e-9	SMART
CHROMO	724	782	1.55e-4	SMART
DEXDc	809	1011	4.13e-37	SMART
HELICc	1165	1249	1.01e-22	SMART
low complexity region	1335	1345	N/A	INTRINSIC
low complexity region	1422	1441	N/A	INTRINSIC
Blast:DEXDc	1460	1505	4e-16	BLAST
low complexity region	1579	1590	N/A	INTRINSIC
low complexity region	1703	1714	N/A	INTRINSIC
low complexity region	1770	1785	N/A	INTRINSIC
low complexity region	1887	1903	N/A	INTRINSIC
low complexity region	2063	2107	N/A	INTRINSIC
low complexity region	2222	2239	N/A	INTRINSIC
BRK	2312	2356	1.34e-19	SMART
BRK	2381	2421	1.94e-2	SMART
low complexity region	2452	2472	N/A	INTRINSIC
low complexity region	2494	2510	N/A	INTRINSIC
low complexity region	2514	2529	N/A	INTRINSIC
low complexity region	2538	2550	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149694

Predicted Effect

SMART Domains

Protein: ENSMUSP00000122995
Gene: ENSMUSG00000053754
AA Change: D291G

Domain	Start	End	E-Value	Type
low complexity region	74	93	N/A	INTRINSIC
Blast:DEXDc	112	235	9e-40	BLAST
low complexity region	239	250	N/A	INTRINSIC
low complexity region	363	374	N/A	INTRINSIC
low complexity region	430	445	N/A	INTRINSIC
Blast:SANT	456	515	1e-29	BLAST
low complexity region	547	563	N/A	INTRINSIC
low complexity region	723	767	N/A	INTRINSIC
low complexity region	882	899	N/A	INTRINSIC
BRK	972	1016	1.34e-19	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000200169
AA Change: D556G

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000142890
Gene: ENSMUSG00000053754
AA Change: D556G

Domain	Start	End	E-Value	Type
low complexity region	255	272	N/A	INTRINSIC
low complexity region	340	374	N/A	INTRINSIC
low complexity region	404	437	N/A	INTRINSIC
low complexity region	463	477	N/A	INTRINSIC
low complexity region	497	534	N/A	INTRINSIC
low complexity region	588	607	N/A	INTRINSIC
CHROMO	642	708	1.8e-9	SMART
CHROMO	724	782	1.55e-4	SMART
DEXDc	809	1011	4.13e-37	SMART
HELICc	1165	1249	1.01e-22	SMART
low complexity region	1335	1345	N/A	INTRINSIC
low complexity region	1422	1441	N/A	INTRINSIC
Blast:DEXDc	1460	1505	4e-16	BLAST
low complexity region	1579	1590	N/A	INTRINSIC
low complexity region	1703	1714	N/A	INTRINSIC
low complexity region	1770	1785	N/A	INTRINSIC
low complexity region	1887	1903	N/A	INTRINSIC
low complexity region	2063	2107	N/A	INTRINSIC
low complexity region	2222	2239	N/A	INTRINSIC
BRK	2312	2356	1.34e-19	SMART
BRK	2381	2421	1.94e-2	SMART
low complexity region	2452	2472	N/A	INTRINSIC
low complexity region	2494	2510	N/A	INTRINSIC
low complexity region	2514	2529	N/A	INTRINSIC
low complexity region	2538	2550	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226625

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 90.8%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the chromodomain-helicase-DNA binding protein family, which is characterized by a SNF2-like domain and two chromatin organization modifier domains. The encoded protein also contains brahma and kismet domains, which is common to the subfamily of chromodomain-helicase-DNA binding proteins to which this protein belongs. In mammals, this gene has been shown to function in several processes including transcriptional regulation, epigenetic remodeling, promotion of cell proliferation, and regulation of RNA synthesis. Knockout of this gene causes early embryonic lethality due to widespread apoptosis. Heterozygous loss of function mutations result in autism spectrum disorder-like behaviors that include increased anxiety, repetitive behavior, and altered social behavior. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous null embryos are growth retarded starting at E5.5 and exhibit developmental arrest at E6.5. Mutants develop into an egg cylinder but do not form a primitive streak or mesoderm and exhibit increased apoptosis at E7.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arid2	A	G	15: 96,361,799	D280G	probably damaging	Het
Azi2	C	T	9: 118,049,322	R77*	probably null	Het
Cit	T	C	5: 115,947,924	M849T	probably damaging	Het
Cit	T	C	5: 116,005,840	S1923P	probably damaging	Het
Col17a1	T	A	19: 47,650,746	H1120L	probably benign	Het
Col6a5	G	T	9: 105,936,994	H606Q	unknown	Het
Dnajc2	A	C	5: 21,776,790	H45Q	probably damaging	Het
Dpp6	A	G	5: 27,709,459	D514G	possibly damaging	Het
Dync2h1	A	G	9: 7,129,062	S1818P	probably damaging	Het
Efemp1	A	T	11: 28,914,696	Y250F	possibly damaging	Het
Emc1	G	A	4: 139,360,946	E342K	possibly damaging	Het
Fam214a	A	G	9: 75,010,390	D757G	probably damaging	Het
Fam3c	T	C	6: 22,329,593	D45G	probably benign	Het
Fchsd2	A	C	7: 101,198,533	D210A	possibly damaging	Het
Flg	T	A	3: 93,279,415	M58K	probably damaging	Het
Gabra5	G	A	7: 57,488,950	R117C	probably damaging	Het
Gm6741	G	A	17: 91,236,881	S24N	probably benign	Het
Grin2a	T	C	16: 9,644,243	D675G	possibly damaging	Het
Hectd4	T	G	5: 121,281,918	V642G	possibly damaging	Het
Herc6	C	T	6: 57,583,332	T119M	probably benign	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hmgcs2	T	C	3: 98,299,214	S371P	probably damaging	Het
Idua	C	T	5: 108,680,734	A271V	probably damaging	Het
Inpp5d	T	A	1: 87,695,350	C125*	probably null	Het
Krt14	C	T	11: 100,207,218	G80R	unknown	Het
Lama5	T	C	2: 180,179,130	Y3176C	probably benign	Het
Lce1k	C	T	3: 92,806,502	C125Y	unknown	Het
Lig4	A	T	8: 9,972,436	L448Q	probably damaging	Het
Macf1	C	T	4: 123,371,918	A4821T	probably damaging	Het
Meioc	C	T	11: 102,675,358	A600V	probably benign	Het
Mepe	T	C	5: 104,327,091	S13P	possibly damaging	Het
Mms22l	A	G	4: 24,588,365	Y999C	probably damaging	Het
Ncbp3	T	A	11: 73,053,520	M116K	possibly damaging	Het
Ndufa10	A	G	1: 92,439,892	Y339H	probably damaging	Het
Nkx3-1	T	C	14: 69,190,817	I38T	probably damaging	Het
Nup155	A	T	15: 8,157,760	H1391L	probably damaging	Het
Olfr1299	T	A	2: 111,664,823	M199K	possibly damaging	Het
Padi6	T	G	4: 140,728,968	I572L	possibly damaging	Het
Pdss2	A	T	10: 43,393,875	N238I	possibly damaging	Het
Pkd1l2	A	G	8: 117,019,533	V1906A	probably benign	Het
Pom121	T	C	5: 135,381,550		probably benign	Het
Psmd9	T	C	5: 123,241,862	F115L	probably damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Rai1	T	C	11: 60,185,589	F160L	probably damaging	Het
Rhbdl2	A	T	4: 123,826,872	R234S	probably damaging	Het
Rnase2a	T	A	14: 51,255,788	Y40F	probably damaging	Het
Setd2	T	C	9: 110,549,133	V672A	possibly damaging	Het
Sgpp2	A	G	1: 78,417,220	I287V	probably benign	Het
Sh3pxd2a	T	C	19: 47,267,264	E1033G	probably benign	Het
Slc5a9	G	A	4: 111,890,531	T284I	probably damaging	Het
Slfn9	A	G	11: 82,981,681	L743P	probably damaging	Het
Smchd1	T	A	17: 71,370,928	N1473I	probably benign	Het
Stx1b	A	T	7: 127,815,403	D16E	probably benign	Het
Tectb	T	C	19: 55,181,929	F71L	probably damaging	Het
Tmem220	T	C	11: 67,034,153	I138T	possibly damaging	Het
Tmtc4	T	C	14: 122,921,265	N682S	probably benign	Het
Tnc	A	G	4: 63,964,621	V1921A	probably damaging	Het
Ubn1	T	G	16: 5,064,623	L316W	probably damaging	Het
Vwa5a	T	C	9: 38,736,061	S579P	probably damaging	Het
Xdh	A	G	17: 73,921,305	L367P	possibly damaging	Het
Zfp280b	T	C	10: 76,038,494	L69S	probably damaging	Het
Zfp990	A	C	4: 145,537,404	Y324S	possibly damaging	Het

Other mutations in Chd8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Chd8	APN	14	52226138	missense	probably damaging	0.99
IGL00694:Chd8	APN	14	52217970	missense	probably damaging	1.00
IGL01011:Chd8	APN	14	52231532	missense	possibly damaging	0.86
IGL01022:Chd8	APN	14	52236993	missense	probably benign
IGL01066:Chd8	APN	14	52217766	missense	probably damaging	1.00
IGL01083:Chd8	APN	14	52221420	missense	probably damaging	1.00
IGL01313:Chd8	APN	14	52210575	missense	probably damaging	1.00
IGL01396:Chd8	APN	14	52204587	unclassified	probably benign
IGL01476:Chd8	APN	14	52205490	missense	probably benign	0.32
IGL01731:Chd8	APN	14	52212654	missense	probably benign	0.12
IGL01895:Chd8	APN	14	52199094	missense	probably benign	0.00
IGL02090:Chd8	APN	14	52227234	critical splice donor site	probably null
IGL02344:Chd8	APN	14	52201650	missense	probably damaging	1.00
IGL02573:Chd8	APN	14	52219734	missense	possibly damaging	0.95
IGL02601:Chd8	APN	14	52214300	missense	possibly damaging	0.94
IGL02617:Chd8	APN	14	52235191	missense	probably benign	0.34
IGL02873:Chd8	APN	14	52222513	missense	probably damaging	0.99
IGL02974:Chd8	APN	14	52201701	splice site	probably null
IGL03058:Chd8	APN	14	52218273	missense	probably damaging	1.00
IGL03076:Chd8	APN	14	52226162	splice site	probably benign
IGL03239:Chd8	APN	14	52227548	missense	possibly damaging	0.92
PIT4431001:Chd8	UTSW	14	52218249	missense	probably damaging	0.98
PIT4468001:Chd8	UTSW	14	52207996	missense	probably benign
PIT4468001:Chd8	UTSW	14	52217881	missense	possibly damaging	0.95
R0006:Chd8	UTSW	14	52235293	missense	possibly damaging	0.51
R0006:Chd8	UTSW	14	52235293	missense	possibly damaging	0.51
R0022:Chd8	UTSW	14	52232855	missense	probably benign	0.00
R0115:Chd8	UTSW	14	52237206	missense	probably benign	0.00
R0131:Chd8	UTSW	14	52205326	missense	probably benign	0.15
R0131:Chd8	UTSW	14	52205326	missense	probably benign	0.15
R0132:Chd8	UTSW	14	52205326	missense	probably benign	0.15
R0419:Chd8	UTSW	14	52204060	missense	probably benign	0.24
R0440:Chd8	UTSW	14	52204826	missense	possibly damaging	0.91
R0452:Chd8	UTSW	14	52214587	missense	probably damaging	1.00
R0481:Chd8	UTSW	14	52237206	missense	probably benign	0.00
R0624:Chd8	UTSW	14	52219757	missense	possibly damaging	0.65
R0650:Chd8	UTSW	14	52202304	missense	probably benign	0.09
R0691:Chd8	UTSW	14	52213433	missense	probably damaging	0.96
R0790:Chd8	UTSW	14	52204025	missense	probably benign	0.07
R0835:Chd8	UTSW	14	52204025	missense	probably benign	0.07
R1180:Chd8	UTSW	14	52221108	missense	probably damaging	1.00
R1411:Chd8	UTSW	14	52224646	missense	probably benign
R1725:Chd8	UTSW	14	52232573	missense	probably benign	0.08
R1838:Chd8	UTSW	14	52204883	missense	probably benign	0.11
R1839:Chd8	UTSW	14	52204883	missense	probably benign	0.11
R1968:Chd8	UTSW	14	52220993	missense	probably damaging	0.98
R2020:Chd8	UTSW	14	52215241	missense	probably damaging	1.00
R2139:Chd8	UTSW	14	52236971	missense	probably benign	0.32
R2163:Chd8	UTSW	14	52198818	missense	possibly damaging	0.53
R2342:Chd8	UTSW	14	52205217	missense	probably benign	0.25
R2844:Chd8	UTSW	14	52204495	missense	possibly damaging	0.92
R3500:Chd8	UTSW	14	52205653	missense	probably benign	0.00
R3861:Chd8	UTSW	14	52237121	missense	probably benign	0.13
R4154:Chd8	UTSW	14	52207211	unclassified	probably benign
R4445:Chd8	UTSW	14	52204527	splice site	probably null
R4628:Chd8	UTSW	14	52206915	missense	probably benign	0.03
R4779:Chd8	UTSW	14	52231506	missense	probably damaging	1.00
R4783:Chd8	UTSW	14	52205368	missense	probably damaging	1.00
R4784:Chd8	UTSW	14	52205368	missense	probably damaging	1.00
R5001:Chd8	UTSW	14	52203915	missense	probably benign	0.09
R5280:Chd8	UTSW	14	52205125	missense	possibly damaging	0.68
R5331:Chd8	UTSW	14	52202114	intron	probably benign
R5348:Chd8	UTSW	14	52232698	missense	probably damaging	1.00
R5375:Chd8	UTSW	14	52204154	missense	probably damaging	1.00
R5470:Chd8	UTSW	14	52212609	missense	probably damaging	1.00
R5479:Chd8	UTSW	14	52215195	missense	probably benign	0.15
R5488:Chd8	UTSW	14	52213048	intron	probably benign
R5489:Chd8	UTSW	14	52213048	intron	probably benign
R5499:Chd8	UTSW	14	52204431	critical splice donor site	probably null
R5988:Chd8	UTSW	14	52217938	missense	probably damaging	1.00
R6046:Chd8	UTSW	14	52221071	missense	possibly damaging	0.60
R6125:Chd8	UTSW	14	52207034	missense	probably benign	0.16
R6212:Chd8	UTSW	14	52201698	missense	probably damaging	1.00
R6337:Chd8	UTSW	14	52204109	missense	probably damaging	1.00
R6394:Chd8	UTSW	14	52202585	missense	possibly damaging	0.66
R6576:Chd8	UTSW	14	52216076	missense	probably damaging	1.00
R6590:Chd8	UTSW	14	52227237	missense	possibly damaging	0.60
R6690:Chd8	UTSW	14	52227237	missense	possibly damaging	0.60
R6786:Chd8	UTSW	14	52226668	missense	probably benign	0.33
R6913:Chd8	UTSW	14	52214494	missense	probably damaging	0.99
R7090:Chd8	UTSW	14	52215220	missense	probably damaging	0.99
R7107:Chd8	UTSW	14	52212672	missense	probably benign	0.07
R7138:Chd8	UTSW	14	52214498	missense	possibly damaging	0.83
R7383:Chd8	UTSW	14	52215319	missense	probably damaging	1.00
R7392:Chd8	UTSW	14	52232855	missense	probably benign
R7471:Chd8	UTSW	14	52204112	missense	probably benign
R7625:Chd8	UTSW	14	52237077	missense	probably benign	0.04
R7790:Chd8	UTSW	14	52226082	missense	probably damaging	1.00
R7862:Chd8	UTSW	14	52214277	missense	probably damaging	1.00
R7937:Chd8	UTSW	14	52227506	missense	probably benign	0.02
R8092:Chd8	UTSW	14	52217727	missense	probably damaging	1.00
R8237:Chd8	UTSW	14	52213352	missense	probably damaging	1.00
R8321:Chd8	UTSW	14	52232567	missense	probably benign	0.01
R8371:Chd8	UTSW	14	52232818	missense	probably benign
R8425:Chd8	UTSW	14	52210555	missense	probably damaging	1.00
R8674:Chd8	UTSW	14	52213006	missense	probably damaging	0.98
R8794:Chd8	UTSW	14	52204447	missense	probably damaging	0.98
R8828:Chd8	UTSW	14	52210580	frame shift	probably null
R8909:Chd8	UTSW	14	52212932	missense	possibly damaging	0.82
R9194:Chd8	UTSW	14	52202193	missense	probably benign	0.01
R9278:Chd8	UTSW	14	52235170	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AGCTTCCATGGTGTGTTCAG -3'
(R):5'- CAGACTCTGTACTTCGCAGC -3'

Sequencing Primer
(F):5'- CAGTTCTTGTAACACAGGAATTTGGG -3'
(R):5'- CGCAGCATTTGTACTATAGACTGG -3'

Posted On

2014-08-25