Incidental Mutation 'R2024:Grin2a'
ID220347
Institutional Source Beutler Lab
Gene Symbol Grin2a
Ensembl Gene ENSMUSG00000059003
Gene Nameglutamate receptor, ionotropic, NMDA2A (epsilon 1)
SynonymsNR2A, GluRepsilon1, NMDAR2A, GluN2A
MMRRC Submission 040033-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.497) question?
Stock #R2024 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location9567898-9995560 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 9644243 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 675 (D675G)
Ref Sequence ENSEMBL: ENSMUSP00000142900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032331] [ENSMUST00000115835] [ENSMUST00000199708]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032331
AA Change: D675G

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000032331
Gene: ENSMUSG00000059003
AA Change: D675G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:ANF_receptor 106 301 1.6e-10 PFAM
PBPe 431 798 1.68e-70 SMART
Lig_chan-Glu_bd 439 502 2.24e-22 SMART
transmembrane domain 818 837 N/A INTRINSIC
Pfam:NMDAR2_C 839 1464 2.1e-230 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115835
AA Change: D675G

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000111501
Gene: ENSMUSG00000059003
AA Change: D675G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:ANF_receptor 99 300 9.2e-11 PFAM
PBPe 431 798 1.68e-70 SMART
Lig_chan-Glu_bd 439 502 2.24e-22 SMART
transmembrane domain 818 837 N/A INTRINSIC
Pfam:NMDAR2_C 839 1464 1.2e-266 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000199708
AA Change: D675G

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142900
Gene: ENSMUSG00000059003
AA Change: D675G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:ANF_receptor 106 301 1.6e-10 PFAM
PBPe 431 798 1.68e-70 SMART
Lig_chan-Glu_bd 439 502 2.24e-22 SMART
transmembrane domain 818 837 N/A INTRINSIC
Pfam:NMDAR2_C 839 1464 2.1e-230 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glutamate-gated ion channel protein family. The encoded protein is an N-methyl-D-aspartate (NMDA) receptor subunit. NMDA receptors are both ligand-gated and voltage-dependent, and are involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. These receptors are permeable to calcium ions, and activation results in a calcium influx into post-synaptic cells, which results in the activation of several signaling cascades. Disruption of this gene is associated with focal epilepsy and speech disorder with or without mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit jumpiness, mildly impaired long-term potentiation and spatial learning, increased locomotor activity and metabolism of dopamine and serotonin, and loss of analgesic tolerance after repeated morphine doses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid2 A G 15: 96,361,799 D280G probably damaging Het
Azi2 C T 9: 118,049,322 R77* probably null Het
Chd8 T C 14: 52,231,493 D556G probably benign Het
Cit T C 5: 115,947,924 M849T probably damaging Het
Cit T C 5: 116,005,840 S1923P probably damaging Het
Col17a1 T A 19: 47,650,746 H1120L probably benign Het
Col6a5 G T 9: 105,936,994 H606Q unknown Het
Dnajc2 A C 5: 21,776,790 H45Q probably damaging Het
Dpp6 A G 5: 27,709,459 D514G possibly damaging Het
Dync2h1 A G 9: 7,129,062 S1818P probably damaging Het
Efemp1 A T 11: 28,914,696 Y250F possibly damaging Het
Emc1 G A 4: 139,360,946 E342K possibly damaging Het
Fam214a A G 9: 75,010,390 D757G probably damaging Het
Fam3c T C 6: 22,329,593 D45G probably benign Het
Fchsd2 A C 7: 101,198,533 D210A possibly damaging Het
Flg T A 3: 93,279,415 M58K probably damaging Het
Gabra5 G A 7: 57,488,950 R117C probably damaging Het
Gm6741 G A 17: 91,236,881 S24N probably benign Het
Hectd4 T G 5: 121,281,918 V642G possibly damaging Het
Herc6 C T 6: 57,583,332 T119M probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hmgcs2 T C 3: 98,299,214 S371P probably damaging Het
Idua C T 5: 108,680,734 A271V probably damaging Het
Inpp5d T A 1: 87,695,350 C125* probably null Het
Krt14 C T 11: 100,207,218 G80R unknown Het
Lama5 T C 2: 180,179,130 Y3176C probably benign Het
Lce1k C T 3: 92,806,502 C125Y unknown Het
Lig4 A T 8: 9,972,436 L448Q probably damaging Het
Macf1 C T 4: 123,371,918 A4821T probably damaging Het
Meioc C T 11: 102,675,358 A600V probably benign Het
Mepe T C 5: 104,327,091 S13P possibly damaging Het
Mms22l A G 4: 24,588,365 Y999C probably damaging Het
Ncbp3 T A 11: 73,053,520 M116K possibly damaging Het
Ndufa10 A G 1: 92,439,892 Y339H probably damaging Het
Nkx3-1 T C 14: 69,190,817 I38T probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1299 T A 2: 111,664,823 M199K possibly damaging Het
Padi6 T G 4: 140,728,968 I572L possibly damaging Het
Pdss2 A T 10: 43,393,875 N238I possibly damaging Het
Pkd1l2 A G 8: 117,019,533 V1906A probably benign Het
Pom121 T C 5: 135,381,550 probably benign Het
Psmd9 T C 5: 123,241,862 F115L probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rai1 T C 11: 60,185,589 F160L probably damaging Het
Rhbdl2 A T 4: 123,826,872 R234S probably damaging Het
Rnase2a T A 14: 51,255,788 Y40F probably damaging Het
Setd2 T C 9: 110,549,133 V672A possibly damaging Het
Sgpp2 A G 1: 78,417,220 I287V probably benign Het
Sh3pxd2a T C 19: 47,267,264 E1033G probably benign Het
Slc5a9 G A 4: 111,890,531 T284I probably damaging Het
Slfn9 A G 11: 82,981,681 L743P probably damaging Het
Smchd1 T A 17: 71,370,928 N1473I probably benign Het
Stx1b A T 7: 127,815,403 D16E probably benign Het
Tectb T C 19: 55,181,929 F71L probably damaging Het
Tmem220 T C 11: 67,034,153 I138T possibly damaging Het
Tmtc4 T C 14: 122,921,265 N682S probably benign Het
Tnc A G 4: 63,964,621 V1921A probably damaging Het
Ubn1 T G 16: 5,064,623 L316W probably damaging Het
Vwa5a T C 9: 38,736,061 S579P probably damaging Het
Xdh A G 17: 73,921,305 L367P possibly damaging Het
Zfp280b T C 10: 76,038,494 L69S probably damaging Het
Zfp990 A C 4: 145,537,404 Y324S possibly damaging Het
Other mutations in Grin2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01777:Grin2a APN 16 9644130 missense probably benign 0.29
IGL03288:Grin2a APN 16 9669840 missense possibly damaging 0.85
IGL02796:Grin2a UTSW 16 9585108 missense possibly damaging 0.72
PIT4402001:Grin2a UTSW 16 9644199 missense possibly damaging 0.77
PIT4494001:Grin2a UTSW 16 9585096 missense probably damaging 0.98
R0055:Grin2a UTSW 16 9669807 missense probably damaging 0.99
R0055:Grin2a UTSW 16 9669807 missense probably damaging 0.99
R0164:Grin2a UTSW 16 9994821 critical splice donor site probably null
R0164:Grin2a UTSW 16 9994821 critical splice donor site probably null
R0211:Grin2a UTSW 16 9579173 missense possibly damaging 0.86
R0390:Grin2a UTSW 16 9579585 missense possibly damaging 0.85
R0659:Grin2a UTSW 16 9992472 missense probably damaging 0.98
R0661:Grin2a UTSW 16 9992472 missense probably damaging 0.98
R0734:Grin2a UTSW 16 9579611 missense possibly damaging 0.71
R1524:Grin2a UTSW 16 9663603 missense possibly damaging 0.55
R1542:Grin2a UTSW 16 9579203 missense probably damaging 0.98
R1556:Grin2a UTSW 16 9707715 missense probably benign 0.18
R1605:Grin2a UTSW 16 9663330 missense possibly damaging 0.46
R1792:Grin2a UTSW 16 9992395 missense possibly damaging 0.53
R2057:Grin2a UTSW 16 9669744 missense probably benign 0.14
R2344:Grin2a UTSW 16 9663235 missense probably benign 0.03
R2847:Grin2a UTSW 16 9761965 missense possibly damaging 0.73
R2848:Grin2a UTSW 16 9761965 missense possibly damaging 0.73
R2981:Grin2a UTSW 16 9644223 missense possibly damaging 0.89
R4197:Grin2a UTSW 16 9761967 missense probably damaging 1.00
R4342:Grin2a UTSW 16 9653589 missense possibly damaging 0.52
R4741:Grin2a UTSW 16 9663512 missense probably damaging 1.00
R4891:Grin2a UTSW 16 9657706 missense possibly damaging 0.51
R4925:Grin2a UTSW 16 9669823 missense probably damaging 0.98
R5563:Grin2a UTSW 16 9707717 missense probably benign 0.18
R5645:Grin2a UTSW 16 9992226 missense probably damaging 0.98
R5769:Grin2a UTSW 16 9761526 missense possibly damaging 0.89
R5885:Grin2a UTSW 16 9761905 missense possibly damaging 0.95
R6065:Grin2a UTSW 16 9761907 missense possibly damaging 0.92
R6083:Grin2a UTSW 16 9579540 missense probably benign 0.02
R6137:Grin2a UTSW 16 9653449 missense probably benign 0.32
R6286:Grin2a UTSW 16 9761775 missense possibly damaging 0.93
R6342:Grin2a UTSW 16 9579334 missense probably damaging 0.98
R6697:Grin2a UTSW 16 9669840 missense possibly damaging 0.85
R6924:Grin2a UTSW 16 9663228 missense possibly damaging 0.71
R7070:Grin2a UTSW 16 9579424 missense possibly damaging 0.92
R7235:Grin2a UTSW 16 9579265 missense probably damaging 0.98
R7274:Grin2a UTSW 16 9579122 missense possibly damaging 0.71
R7669:Grin2a UTSW 16 9992463 missense probably benign
X0024:Grin2a UTSW 16 9663199 missense probably benign 0.36
Z1177:Grin2a UTSW 16 9663577 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- ACCAAGCCATGCAGAGTCTG -3'
(R):5'- TCTTAGAGATCGCAGACCCATG -3'

Sequencing Primer
(F):5'- CAAGCCATGCAGAGTCTGTTTCTG -3'
(R):5'- TCGCAGACCCATGGAAGATGTG -3'
Posted On2014-08-25