Incidental Mutation 'R1985:Hdlbp'
ID220401
Institutional Source Beutler Lab
Gene Symbol Hdlbp
Ensembl Gene ENSMUSG00000034088
Gene Namehigh density lipoprotein (HDL) binding protein
Synonyms1110005P14Rik, D1Ertd101e
MMRRC Submission 039997-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R1985 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location93405940-93478815 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93431118 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 237 (I237T)
Ref Sequence ENSEMBL: ENSMUSP00000139671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042498] [ENSMUST00000170883] [ENSMUST00000186164] [ENSMUST00000188988] [ENSMUST00000190321]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042498
AA Change: I237T

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000043047
Gene: ENSMUSG00000034088
AA Change: I237T

DomainStartEndE-ValueType
KH 149 217 1.97e-15 SMART
KH 221 289 1.8e-9 SMART
KH 294 362 1.73e-11 SMART
KH 363 429 2.66e-12 SMART
KH 434 502 9.18e-16 SMART
KH 506 575 7.52e-12 SMART
KH 580 648 7.68e-18 SMART
KH 652 721 3.24e-16 SMART
KH 726 795 1.33e-12 SMART
KH 799 868 2.48e-12 SMART
KH 872 972 3.03e-16 SMART
KH 973 1039 4.56e-11 SMART
KH 1051 1122 3.67e-15 SMART
KH 1126 1195 3.37e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000170883
AA Change: I237T

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127903
Gene: ENSMUSG00000034088
AA Change: I237T

DomainStartEndE-ValueType
KH 149 217 1.97e-15 SMART
KH 221 289 1.8e-9 SMART
KH 294 362 1.73e-11 SMART
KH 363 429 2.66e-12 SMART
KH 434 502 9.18e-16 SMART
KH 506 575 7.52e-12 SMART
KH 580 648 7.68e-18 SMART
KH 652 721 3.24e-16 SMART
KH 726 795 1.33e-12 SMART
KH 799 868 2.48e-12 SMART
KH 872 972 3.03e-16 SMART
KH 973 1039 4.56e-11 SMART
KH 1051 1122 3.67e-15 SMART
KH 1126 1195 3.37e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186164
AA Change: I237T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139671
Gene: ENSMUSG00000034088
AA Change: I237T

DomainStartEndE-ValueType
KH 149 217 1.2e-17 SMART
KH 221 289 1.1e-11 SMART
KH 294 360 1.6e-14 SMART
KH 365 433 5.7e-18 SMART
KH 437 506 4.6e-14 SMART
KH 511 579 4.7e-20 SMART
KH 583 652 2e-18 SMART
KH 657 726 7.9e-15 SMART
KH 730 799 1.5e-14 SMART
KH 803 903 1.8e-18 SMART
KH 904 970 2.8e-13 SMART
KH 982 1053 2.2e-17 SMART
KH 1057 1126 2e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188988
SMART Domains Protein: ENSMUSP00000140946
Gene: ENSMUSG00000034088

DomainStartEndE-ValueType
Blast:KH 74 148 2e-28 BLAST
Pfam:KH_1 152 177 2e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189951
Predicted Effect probably benign
Transcript: ENSMUST00000190321
Meta Mutation Damage Score 0.5232 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 94% (76/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds high density lipoprotein (HDL) and may function to regulate excess cholesterol levels in cells. The encoded protein also binds RNA and can induce heterochromatin formation. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190007I07Rik T A 10: 82,620,217 T37S possibly damaging Het
AA792892 A T 5: 94,384,072 I272L probably benign Het
Abhd8 C A 8: 71,463,513 probably benign Het
Adam5 A T 8: 24,746,739 D648E probably benign Het
Akr1d1 A G 6: 37,558,401 D240G probably damaging Het
Ankmy2 A G 12: 36,157,364 H3R possibly damaging Het
Anpep A C 7: 79,840,857 probably null Het
Apobr A G 7: 126,587,731 T20A possibly damaging Het
Atp2a2 A T 5: 122,466,836 Y427N probably benign Het
Camkk2 A C 5: 122,764,127 S40A possibly damaging Het
Camp T C 9: 109,848,429 N112S probably benign Het
Cbx7 A G 15: 79,918,390 S229P probably damaging Het
Cnot2 T C 10: 116,527,876 N41S probably damaging Het
Dchs1 A G 7: 105,772,398 F272L possibly damaging Het
Dct T C 14: 118,036,542 K318E probably benign Het
Dhrs11 A C 11: 84,828,807 L31V probably damaging Het
Dnah7a T C 1: 53,503,934 D2359G probably benign Het
Dnajc7 A G 11: 100,590,892 S305P probably benign Het
Dscc1 CTGAATGAAT CTGAAT 15: 55,080,176 probably benign Het
Fam71b T C 11: 46,407,866 *666Q probably null Het
Flnc A G 6: 29,444,416 probably benign Het
Gm7535 A G 17: 17,911,538 probably benign Het
Grtp1 A G 8: 13,179,376 F313L probably damaging Het
Haus6 T C 4: 86,593,609 Y425C possibly damaging Het
Hdac1 T A 4: 129,528,960 N83Y possibly damaging Het
Hfm1 A T 5: 106,898,576 D481E probably damaging Het
Hipk3 T C 2: 104,434,435 I737V probably benign Het
Il23r T A 6: 67,490,668 probably null Het
Il24 G A 1: 130,882,531 T196I probably benign Het
Ints3 C T 3: 90,400,303 probably null Het
Kcna6 T C 6: 126,738,510 E472G probably benign Het
Kcnj16 C T 11: 111,025,583 T357M probably benign Het
Kdm4b T A 17: 56,401,302 V957E probably damaging Het
Kif21b G A 1: 136,147,546 D166N probably damaging Het
Klhl11 G T 11: 100,463,244 Q584K probably benign Het
Krt9 A T 11: 100,189,991 M345K probably benign Het
Lgr5 T C 10: 115,495,245 probably benign Het
Lilr4b A T 10: 51,481,735 Q80L possibly damaging Het
Lrrc69 T C 4: 14,708,669 E225G possibly damaging Het
Ly9 A G 1: 171,599,773 S405P probably damaging Het
Myh2 A G 11: 67,180,914 D519G possibly damaging Het
Nav3 G A 10: 109,770,184 probably benign Het
Nfkb1 G A 3: 135,615,349 T215I possibly damaging Het
Ninj2 A T 6: 120,198,639 probably benign Het
Obsl1 A G 1: 75,505,600 C209R probably damaging Het
Olfr1393 T C 11: 49,280,283 I45T probably damaging Het
Olfr314 A C 11: 58,786,384 D50A probably damaging Het
Olfr531 A T 7: 140,400,800 M82K possibly damaging Het
Olfr539 G A 7: 140,667,821 C171Y probably damaging Het
Olfr619 A T 7: 103,603,672 Y6F probably benign Het
Olfr710 A G 7: 106,944,926 I25T probably benign Het
Otud4 G C 8: 79,640,012 R36P probably damaging Het
Pcnt C T 10: 76,380,337 R2239H possibly damaging Het
Pgbd5 T A 8: 124,370,592 M491L probably benign Het
Pitrm1 A T 13: 6,558,184 D316V probably damaging Het
Plod3 A G 5: 136,990,853 probably null Het
Plppr3 A T 10: 79,867,460 Y63* probably null Het
Prickle2 T C 6: 92,411,452 D323G probably damaging Het
Psmd11 A T 11: 80,445,263 I114F probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rbp3 T G 14: 33,956,461 S789A probably benign Het
Rfxap C A 3: 54,807,326 R117L probably damaging Het
Rims2 T A 15: 39,345,314 M171K probably damaging Het
Scin A G 12: 40,133,908 probably null Het
Scn11a A G 9: 119,754,678 S1624P probably benign Het
Slc41a3 G A 6: 90,642,228 V330M probably damaging Het
Slc9c1 A G 16: 45,550,106 I237V probably benign Het
Spag6 A G 2: 18,732,119 I218V probably benign Het
Stam2 T C 2: 52,709,626 T257A possibly damaging Het
Tbc1d24 G A 17: 24,207,964 R318* probably null Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Trpm3 T A 19: 22,926,082 Y1069N possibly damaging Het
Tuba8 A G 6: 121,220,520 D47G probably benign Het
Tulp3 A T 6: 128,326,806 S277T probably benign Het
Wdr7 GTT GT 18: 63,760,583 probably null Het
Ybx2 A G 11: 69,936,468 probably null Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp788 T A 7: 41,650,481 I795N probably damaging Het
Other mutations in Hdlbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Hdlbp APN 1 93430169 missense probably benign 0.00
IGL01321:Hdlbp APN 1 93423802 missense probably damaging 1.00
IGL01387:Hdlbp APN 1 93413588 missense possibly damaging 0.91
IGL01443:Hdlbp APN 1 93431074 missense probably damaging 0.99
IGL01467:Hdlbp APN 1 93417698 splice site probably benign
IGL02223:Hdlbp APN 1 93412449 missense probably damaging 1.00
IGL02274:Hdlbp APN 1 93408507 splice site probably null
IGL02452:Hdlbp APN 1 93417511 missense probably damaging 1.00
IGL03079:Hdlbp APN 1 93413940 splice site probably benign
IGL03169:Hdlbp APN 1 93416587 missense possibly damaging 0.92
IGL03229:Hdlbp APN 1 93430187 missense probably benign 0.00
R0119:Hdlbp UTSW 1 93421337 splice site probably benign
R0432:Hdlbp UTSW 1 93425332 missense probably damaging 1.00
R0508:Hdlbp UTSW 1 93414811 critical splice donor site probably null
R0530:Hdlbp UTSW 1 93430317 unclassified probably benign
R1276:Hdlbp UTSW 1 93421101 missense probably benign 0.12
R1302:Hdlbp UTSW 1 93423385 splice site probably null
R1331:Hdlbp UTSW 1 93421131 missense probably damaging 1.00
R1537:Hdlbp UTSW 1 93417374 missense probably benign 0.01
R1623:Hdlbp UTSW 1 93423869 missense probably damaging 1.00
R1695:Hdlbp UTSW 1 93437200 missense probably damaging 1.00
R1897:Hdlbp UTSW 1 93422285 intron probably benign
R1900:Hdlbp UTSW 1 93422237 intron probably benign
R1984:Hdlbp UTSW 1 93431118 missense probably damaging 0.98
R2066:Hdlbp UTSW 1 93421880 intron probably benign
R2277:Hdlbp UTSW 1 93408178 nonsense probably null
R2349:Hdlbp UTSW 1 93422234 intron probably benign
R3434:Hdlbp UTSW 1 93428161 missense probably benign 0.04
R3978:Hdlbp UTSW 1 93421351 missense probably damaging 1.00
R4645:Hdlbp UTSW 1 93422120 intron probably benign
R5196:Hdlbp UTSW 1 93420193 missense probably damaging 1.00
R5760:Hdlbp UTSW 1 93440777 intron probably benign
R6327:Hdlbp UTSW 1 93429464 missense possibly damaging 0.87
R6420:Hdlbp UTSW 1 93431004 missense probably damaging 1.00
R6428:Hdlbp UTSW 1 93431445 missense possibly damaging 0.91
R6468:Hdlbp UTSW 1 93417667 missense possibly damaging 0.48
R6488:Hdlbp UTSW 1 93428224 missense probably damaging 1.00
R6592:Hdlbp UTSW 1 93412361 critical splice donor site probably null
R6920:Hdlbp UTSW 1 93412361 critical splice donor site probably null
R7156:Hdlbp UTSW 1 93413915 missense probably damaging 1.00
R7391:Hdlbp UTSW 1 93431061 missense possibly damaging 0.93
R7457:Hdlbp UTSW 1 93428222 missense probably benign 0.04
R7498:Hdlbp UTSW 1 93413615 missense probably benign 0.00
R7554:Hdlbp UTSW 1 93437309 missense probably damaging 0.96
R7593:Hdlbp UTSW 1 93430283 missense probably benign 0.01
R7672:Hdlbp UTSW 1 93437099 missense possibly damaging 0.90
R7904:Hdlbp UTSW 1 93423370 missense probably damaging 1.00
R7987:Hdlbp UTSW 1 93423370 missense probably damaging 1.00
RF020:Hdlbp UTSW 1 93440734 missense probably benign
Z1088:Hdlbp UTSW 1 93431354 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TAACCGTTTTGCTCATGGGC -3'
(R):5'- AGTCCTCCTAATCTCTGCTGAG -3'

Sequencing Primer
(F):5'- TTGCTCATGGGCTCTGC -3'
(R):5'- TGAGACCTCTGAGTGGCCTG -3'
Posted On2014-08-25