Incidental Mutation 'R1985:Il24'
ID220403
Institutional Source Beutler Lab
Gene Symbol Il24
Ensembl Gene ENSMUSG00000026420
Gene Nameinterleukin 24
SynonymsMda-7, FISP
MMRRC Submission 039997-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1985 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location130882074-130887454 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 130882531 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 196 (T196I)
Ref Sequence ENSEMBL: ENSMUSP00000113064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038829] [ENSMUST00000121040] [ENSMUST00000187650] [ENSMUST00000188148] [ENSMUST00000191279]
Predicted Effect probably benign
Transcript: ENSMUST00000038829
SMART Domains Protein: ENSMUSP00000048303
Gene: ENSMUSG00000042474

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:V-set 21 122 1.3e-10 PFAM
low complexity region 212 223 N/A INTRINSIC
transmembrane domain 264 283 N/A INTRINSIC
low complexity region 285 311 N/A INTRINSIC
low complexity region 344 363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121040
AA Change: T196I

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000113064
Gene: ENSMUSG00000026420
AA Change: T196I

DomainStartEndE-ValueType
low complexity region 44 56 N/A INTRINSIC
IL10 76 219 1.14e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126821
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145446
Predicted Effect probably benign
Transcript: ENSMUST00000187650
AA Change: T157I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140149
Gene: ENSMUSG00000026420
AA Change: T157I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IL10 37 180 5.4e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188148
SMART Domains Protein: ENSMUSP00000139907
Gene: ENSMUSG00000026420

DomainStartEndE-ValueType
low complexity region 37 50 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191279
SMART Domains Protein: ENSMUSP00000140821
Gene: ENSMUSG00000026420

DomainStartEndE-ValueType
low complexity region 44 56 N/A INTRINSIC
Blast:IL10 76 118 2e-21 BLAST
SCOP:d2ilk__ 80 119 2e-9 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 94% (76/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IL10 family of cytokines. It was identified as a gene induced during terminal differentiation in melanoma cells. The protein encoded by this gene can induce apoptosis selectively in various cancer cells. Overexpression of this gene leads to elevated expression of several GADD family genes, which correlates with the induction of apoptosis. The phosphorylation of mitogen-activated protein kinase 14 (MAPK7/P38), and heat shock 27kDa protein 1 (HSPB2/HSP27) are found to be induced by this gene in melanoma cells, but not in normal immortal melanocytes. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display normal induction of epidermal hyperplasia in response to intradermal IL-23 treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190007I07Rik T A 10: 82,620,217 T37S possibly damaging Het
AA792892 A T 5: 94,384,072 I272L probably benign Het
Abhd8 C A 8: 71,463,513 probably benign Het
Adam5 A T 8: 24,746,739 D648E probably benign Het
Akr1d1 A G 6: 37,558,401 D240G probably damaging Het
Ankmy2 A G 12: 36,157,364 H3R possibly damaging Het
Anpep A C 7: 79,840,857 probably null Het
Apobr A G 7: 126,587,731 T20A possibly damaging Het
Atp2a2 A T 5: 122,466,836 Y427N probably benign Het
Camkk2 A C 5: 122,764,127 S40A possibly damaging Het
Camp T C 9: 109,848,429 N112S probably benign Het
Cbx7 A G 15: 79,918,390 S229P probably damaging Het
Cnot2 T C 10: 116,527,876 N41S probably damaging Het
Dchs1 A G 7: 105,772,398 F272L possibly damaging Het
Dct T C 14: 118,036,542 K318E probably benign Het
Dhrs11 A C 11: 84,828,807 L31V probably damaging Het
Dnah7a T C 1: 53,503,934 D2359G probably benign Het
Dnajc7 A G 11: 100,590,892 S305P probably benign Het
Dscc1 CTGAATGAAT CTGAAT 15: 55,080,176 probably benign Het
Fam71b T C 11: 46,407,866 *666Q probably null Het
Flnc A G 6: 29,444,416 probably benign Het
Gm7535 A G 17: 17,911,538 probably benign Het
Grtp1 A G 8: 13,179,376 F313L probably damaging Het
Haus6 T C 4: 86,593,609 Y425C possibly damaging Het
Hdac1 T A 4: 129,528,960 N83Y possibly damaging Het
Hdlbp A G 1: 93,431,118 I237T probably damaging Het
Hfm1 A T 5: 106,898,576 D481E probably damaging Het
Hipk3 T C 2: 104,434,435 I737V probably benign Het
Il23r T A 6: 67,490,668 probably null Het
Ints3 C T 3: 90,400,303 probably null Het
Kcna6 T C 6: 126,738,510 E472G probably benign Het
Kcnj16 C T 11: 111,025,583 T357M probably benign Het
Kdm4b T A 17: 56,401,302 V957E probably damaging Het
Kif21b G A 1: 136,147,546 D166N probably damaging Het
Klhl11 G T 11: 100,463,244 Q584K probably benign Het
Krt9 A T 11: 100,189,991 M345K probably benign Het
Lgr5 T C 10: 115,495,245 probably benign Het
Lilr4b A T 10: 51,481,735 Q80L possibly damaging Het
Lrrc69 T C 4: 14,708,669 E225G possibly damaging Het
Ly9 A G 1: 171,599,773 S405P probably damaging Het
Myh2 A G 11: 67,180,914 D519G possibly damaging Het
Nav3 G A 10: 109,770,184 probably benign Het
Nfkb1 G A 3: 135,615,349 T215I possibly damaging Het
Ninj2 A T 6: 120,198,639 probably benign Het
Obsl1 A G 1: 75,505,600 C209R probably damaging Het
Olfr1393 T C 11: 49,280,283 I45T probably damaging Het
Olfr314 A C 11: 58,786,384 D50A probably damaging Het
Olfr531 A T 7: 140,400,800 M82K possibly damaging Het
Olfr539 G A 7: 140,667,821 C171Y probably damaging Het
Olfr619 A T 7: 103,603,672 Y6F probably benign Het
Olfr710 A G 7: 106,944,926 I25T probably benign Het
Otud4 G C 8: 79,640,012 R36P probably damaging Het
Pcnt C T 10: 76,380,337 R2239H possibly damaging Het
Pgbd5 T A 8: 124,370,592 M491L probably benign Het
Pitrm1 A T 13: 6,558,184 D316V probably damaging Het
Plod3 A G 5: 136,990,853 probably null Het
Plppr3 A T 10: 79,867,460 Y63* probably null Het
Prickle2 T C 6: 92,411,452 D323G probably damaging Het
Psmd11 A T 11: 80,445,263 I114F probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rbp3 T G 14: 33,956,461 S789A probably benign Het
Rfxap C A 3: 54,807,326 R117L probably damaging Het
Rims2 T A 15: 39,345,314 M171K probably damaging Het
Scin A G 12: 40,133,908 probably null Het
Scn11a A G 9: 119,754,678 S1624P probably benign Het
Slc41a3 G A 6: 90,642,228 V330M probably damaging Het
Slc9c1 A G 16: 45,550,106 I237V probably benign Het
Spag6 A G 2: 18,732,119 I218V probably benign Het
Stam2 T C 2: 52,709,626 T257A possibly damaging Het
Tbc1d24 G A 17: 24,207,964 R318* probably null Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Trpm3 T A 19: 22,926,082 Y1069N possibly damaging Het
Tuba8 A G 6: 121,220,520 D47G probably benign Het
Tulp3 A T 6: 128,326,806 S277T probably benign Het
Wdr7 GTT GT 18: 63,760,583 probably null Het
Ybx2 A G 11: 69,936,468 probably null Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp788 T A 7: 41,650,481 I795N probably damaging Het
Other mutations in Il24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01934:Il24 APN 1 130883877 missense probably damaging 1.00
IGL02540:Il24 APN 1 130887303 unclassified probably benign
IGL02959:Il24 APN 1 130885733 nonsense probably null
IGL03191:Il24 APN 1 130884847 missense probably benign 0.06
R0360:Il24 UTSW 1 130883937 missense probably damaging 1.00
R1738:Il24 UTSW 1 130887362 unclassified probably null
R1755:Il24 UTSW 1 130883943 missense possibly damaging 0.58
R1984:Il24 UTSW 1 130882531 missense probably benign 0.01
R1986:Il24 UTSW 1 130882531 missense probably benign 0.01
R2090:Il24 UTSW 1 130884837 missense possibly damaging 0.90
R4970:Il24 UTSW 1 130883442 intron probably null
R5112:Il24 UTSW 1 130883442 intron probably null
R5590:Il24 UTSW 1 130882516 missense possibly damaging 0.72
R6128:Il24 UTSW 1 130885698 missense probably damaging 0.97
R7061:Il24 UTSW 1 130883371 missense possibly damaging 0.81
X0021:Il24 UTSW 1 130885585 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CAAGGGTCTGAAGTGCCTTG -3'
(R):5'- GCATCCAAGGTTCTTGTGTTC -3'

Sequencing Primer
(F):5'- TCTGAAGTGCCTTGAGGACAGC -3'
(R):5'- TTGTCCTCACCCTGAAAACG -3'
Posted On2014-08-25