Incidental Mutation 'R1985:Ints3'
ID220419
Institutional Source Beutler Lab
Gene Symbol Ints3
Ensembl Gene ENSMUSG00000027933
Gene Nameintegrator complex subunit 3
Synonyms
MMRRC Submission 039997-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R1985 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location90391388-90433622 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 90400303 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029542] [ENSMUST00000071488] [ENSMUST00000196530]
Predicted Effect probably null
Transcript: ENSMUST00000029542
SMART Domains Protein: ENSMUSP00000029542
Gene: ENSMUSG00000027933

DomainStartEndE-ValueType
low complexity region 11 33 N/A INTRINSIC
Pfam:DUF2356 269 493 6e-110 PFAM
low complexity region 557 568 N/A INTRINSIC
low complexity region 632 647 N/A INTRINSIC
low complexity region 666 678 N/A INTRINSIC
coiled coil region 913 940 N/A INTRINSIC
low complexity region 1006 1019 N/A INTRINSIC
low complexity region 1021 1031 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000071488
SMART Domains Protein: ENSMUSP00000071422
Gene: ENSMUSG00000027933

DomainStartEndE-ValueType
low complexity region 11 33 N/A INTRINSIC
Pfam:DUF2356 269 493 6e-110 PFAM
low complexity region 557 568 N/A INTRINSIC
low complexity region 632 647 N/A INTRINSIC
low complexity region 666 678 N/A INTRINSIC
coiled coil region 913 940 N/A INTRINSIC
low complexity region 1006 1019 N/A INTRINSIC
low complexity region 1021 1031 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000196530
SMART Domains Protein: ENSMUSP00000143196
Gene: ENSMUSG00000027933

DomainStartEndE-ValueType
low complexity region 11 33 N/A INTRINSIC
Pfam:DUF2356 268 497 5.7e-114 PFAM
low complexity region 557 568 N/A INTRINSIC
low complexity region 632 647 N/A INTRINSIC
low complexity region 666 678 N/A INTRINSIC
coiled coil region 913 940 N/A INTRINSIC
low complexity region 1006 1018 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198776
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199158
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199992
Meta Mutation Damage Score 0.9592 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 94% (76/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can form a complex with human single-strand DNA binding proteins 1 or 2 (hSSB1 and hSSB2) and other proteins to mediate genome stability and the DNA damage response. The encoded protein is also part of a multiprotein complex that interacts with the C-terminal domain of RNA polymerase II large subunit to help regulate processing of U1 and U2 small nuclear RNAs. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190007I07Rik T A 10: 82,620,217 T37S possibly damaging Het
AA792892 A T 5: 94,384,072 I272L probably benign Het
Abhd8 C A 8: 71,463,513 probably benign Het
Adam5 A T 8: 24,746,739 D648E probably benign Het
Akr1d1 A G 6: 37,558,401 D240G probably damaging Het
Ankmy2 A G 12: 36,157,364 H3R possibly damaging Het
Anpep A C 7: 79,840,857 probably null Het
Apobr A G 7: 126,587,731 T20A possibly damaging Het
Atp2a2 A T 5: 122,466,836 Y427N probably benign Het
Camkk2 A C 5: 122,764,127 S40A possibly damaging Het
Camp T C 9: 109,848,429 N112S probably benign Het
Cbx7 A G 15: 79,918,390 S229P probably damaging Het
Cnot2 T C 10: 116,527,876 N41S probably damaging Het
Dchs1 A G 7: 105,772,398 F272L possibly damaging Het
Dct T C 14: 118,036,542 K318E probably benign Het
Dhrs11 A C 11: 84,828,807 L31V probably damaging Het
Dnah7a T C 1: 53,503,934 D2359G probably benign Het
Dnajc7 A G 11: 100,590,892 S305P probably benign Het
Dscc1 CTGAATGAAT CTGAAT 15: 55,080,176 probably benign Het
Fam71b T C 11: 46,407,866 *666Q probably null Het
Flnc A G 6: 29,444,416 probably benign Het
Gm7535 A G 17: 17,911,538 probably benign Het
Grtp1 A G 8: 13,179,376 F313L probably damaging Het
Haus6 T C 4: 86,593,609 Y425C possibly damaging Het
Hdac1 T A 4: 129,528,960 N83Y possibly damaging Het
Hdlbp A G 1: 93,431,118 I237T probably damaging Het
Hfm1 A T 5: 106,898,576 D481E probably damaging Het
Hipk3 T C 2: 104,434,435 I737V probably benign Het
Il23r T A 6: 67,490,668 probably null Het
Il24 G A 1: 130,882,531 T196I probably benign Het
Kcna6 T C 6: 126,738,510 E472G probably benign Het
Kcnj16 C T 11: 111,025,583 T357M probably benign Het
Kdm4b T A 17: 56,401,302 V957E probably damaging Het
Kif21b G A 1: 136,147,546 D166N probably damaging Het
Klhl11 G T 11: 100,463,244 Q584K probably benign Het
Krt9 A T 11: 100,189,991 M345K probably benign Het
Lgr5 T C 10: 115,495,245 probably benign Het
Lilr4b A T 10: 51,481,735 Q80L possibly damaging Het
Lrrc69 T C 4: 14,708,669 E225G possibly damaging Het
Ly9 A G 1: 171,599,773 S405P probably damaging Het
Myh2 A G 11: 67,180,914 D519G possibly damaging Het
Nav3 G A 10: 109,770,184 probably benign Het
Nfkb1 G A 3: 135,615,349 T215I possibly damaging Het
Ninj2 A T 6: 120,198,639 probably benign Het
Obsl1 A G 1: 75,505,600 C209R probably damaging Het
Olfr1393 T C 11: 49,280,283 I45T probably damaging Het
Olfr314 A C 11: 58,786,384 D50A probably damaging Het
Olfr531 A T 7: 140,400,800 M82K possibly damaging Het
Olfr539 G A 7: 140,667,821 C171Y probably damaging Het
Olfr619 A T 7: 103,603,672 Y6F probably benign Het
Olfr710 A G 7: 106,944,926 I25T probably benign Het
Otud4 G C 8: 79,640,012 R36P probably damaging Het
Pcnt C T 10: 76,380,337 R2239H possibly damaging Het
Pgbd5 T A 8: 124,370,592 M491L probably benign Het
Pitrm1 A T 13: 6,558,184 D316V probably damaging Het
Plod3 A G 5: 136,990,853 probably null Het
Plppr3 A T 10: 79,867,460 Y63* probably null Het
Prickle2 T C 6: 92,411,452 D323G probably damaging Het
Psmd11 A T 11: 80,445,263 I114F probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rbp3 T G 14: 33,956,461 S789A probably benign Het
Rfxap C A 3: 54,807,326 R117L probably damaging Het
Rims2 T A 15: 39,345,314 M171K probably damaging Het
Scin A G 12: 40,133,908 probably null Het
Scn11a A G 9: 119,754,678 S1624P probably benign Het
Slc41a3 G A 6: 90,642,228 V330M probably damaging Het
Slc9c1 A G 16: 45,550,106 I237V probably benign Het
Spag6 A G 2: 18,732,119 I218V probably benign Het
Stam2 T C 2: 52,709,626 T257A possibly damaging Het
Tbc1d24 G A 17: 24,207,964 R318* probably null Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Trpm3 T A 19: 22,926,082 Y1069N possibly damaging Het
Tuba8 A G 6: 121,220,520 D47G probably benign Het
Tulp3 A T 6: 128,326,806 S277T probably benign Het
Wdr7 GTT GT 18: 63,760,583 probably null Het
Ybx2 A G 11: 69,936,468 probably null Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp788 T A 7: 41,650,481 I795N probably damaging Het
Other mutations in Ints3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ints3 APN 3 90406329 missense probably damaging 1.00
IGL01339:Ints3 APN 3 90415156 critical splice donor site probably null
IGL01398:Ints3 APN 3 90392823 missense probably damaging 1.00
IGL01599:Ints3 APN 3 90394322 critical splice donor site probably null
IGL01864:Ints3 APN 3 90415179 missense probably benign 0.33
IGL01984:Ints3 APN 3 90392226 missense possibly damaging 0.79
IGL02325:Ints3 APN 3 90404042 missense probably damaging 1.00
IGL02516:Ints3 APN 3 90403108 missense probably damaging 1.00
IGL02867:Ints3 APN 3 90392836 missense probably damaging 1.00
IGL02889:Ints3 APN 3 90392836 missense probably damaging 1.00
IGL02975:Ints3 APN 3 90401837 splice site probably benign
PIT4431001:Ints3 UTSW 3 90396460 missense probably damaging 0.99
R0003:Ints3 UTSW 3 90408511 missense probably benign 0.00
R0003:Ints3 UTSW 3 90408511 missense probably benign 0.00
R0069:Ints3 UTSW 3 90400647 splice site probably benign
R0069:Ints3 UTSW 3 90400647 splice site probably benign
R1450:Ints3 UTSW 3 90432828 missense probably damaging 1.00
R2324:Ints3 UTSW 3 90394094 missense probably damaging 1.00
R2425:Ints3 UTSW 3 90394110 missense possibly damaging 0.91
R2920:Ints3 UTSW 3 90393162 missense probably benign 0.22
R3937:Ints3 UTSW 3 90403987 nonsense probably null
R4678:Ints3 UTSW 3 90408510 missense possibly damaging 0.47
R4679:Ints3 UTSW 3 90408510 missense possibly damaging 0.47
R4719:Ints3 UTSW 3 90415521 missense probably benign 0.20
R4726:Ints3 UTSW 3 90393777 missense probably damaging 1.00
R4993:Ints3 UTSW 3 90415507 missense probably benign 0.05
R5154:Ints3 UTSW 3 90415561 missense probably benign 0.01
R5243:Ints3 UTSW 3 90401144 frame shift probably null
R5454:Ints3 UTSW 3 90408527 missense possibly damaging 0.72
R5678:Ints3 UTSW 3 90403548 missense probably damaging 0.99
R6123:Ints3 UTSW 3 90413554 missense probably benign 0.01
R6548:Ints3 UTSW 3 90392124 unclassified probably benign
R6916:Ints3 UTSW 3 90406334 missense probably damaging 1.00
R7265:Ints3 UTSW 3 90403983 critical splice donor site probably null
R7332:Ints3 UTSW 3 90415512 missense probably damaging 0.98
R7699:Ints3 UTSW 3 90421804 missense probably benign 0.00
R7700:Ints3 UTSW 3 90421804 missense probably benign 0.00
R7790:Ints3 UTSW 3 90400413 missense probably benign 0.09
R7827:Ints3 UTSW 3 90424012 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AGAAGGTATATTTCTGGCCCATATCTG -3'
(R):5'- GCACCTTAGGAGAGCCTATG -3'

Sequencing Primer
(F):5'- ACATGCCCACTGCTATGGTG -3'
(R):5'- ATGCTAGGTGACACCCTTTTG -3'
Posted On2014-08-25