Incidental Mutation 'R2025:Acan'
ID 220428
Institutional Source Beutler Lab
Gene Symbol Acan
Ensembl Gene ENSMUSG00000030607
Gene Name aggrecan
Synonyms Agc1, Cspg1, b2b183Clo
MMRRC Submission 040034-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2025 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 78703231-78764847 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 78750970 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 1914 (S1914A)
Ref Sequence ENSEMBL: ENSMUSP00000032835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032835]
AlphaFold Q61282
Predicted Effect probably benign
Transcript: ENSMUST00000032835
AA Change: S1914A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032835
Gene: ENSMUSG00000030607
AA Change: S1914A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 46 135 3.46e-7 SMART
LINK 151 248 1.76e-59 SMART
LINK 252 350 4.13e-65 SMART
LINK 485 582 1.03e-51 SMART
LINK 586 684 9.58e-61 SMART
low complexity region 767 794 N/A INTRINSIC
low complexity region 845 859 N/A INTRINSIC
low complexity region 890 904 N/A INTRINSIC
low complexity region 913 930 N/A INTRINSIC
low complexity region 966 987 N/A INTRINSIC
low complexity region 1455 1468 N/A INTRINSIC
low complexity region 1484 1495 N/A INTRINSIC
low complexity region 1707 1720 N/A INTRINSIC
low complexity region 1808 1823 N/A INTRINSIC
low complexity region 1904 1915 N/A INTRINSIC
CLECT 1922 2043 2.13e-37 SMART
CCP 2049 2105 9.32e-11 SMART
low complexity region 2118 2130 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000206779
AA Change: S491A
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Spontaneous mutations in this gene lead to dwarfism, cartilage, skeletal and limb anomalies, craniofacial defects, hearing loss and neonatal death due to respiratory failure. Homozygotes for an ENU-induced allele show cardiomyopathy as well as cleft palate, disproportionate dwarfism and brachypodia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 T C 14: 118,790,737 (GRCm39) M757V probably benign Het
Abitram T A 4: 56,805,916 (GRCm39) I138N probably damaging Het
Axin2 T A 11: 108,833,904 (GRCm39) V617D probably damaging Het
Bhlhe22 A G 3: 18,109,975 (GRCm39) S342G probably benign Het
Cald1 AAGAGAGAGAGAGAG AAGAGAGAGAGAG 6: 34,723,108 (GRCm39) probably null Het
Ccdc34 A G 2: 109,862,731 (GRCm39) K179E possibly damaging Het
Clasp1 A G 1: 118,432,629 (GRCm39) T208A probably damaging Het
Crabp1 C T 9: 54,675,752 (GRCm39) R112* probably null Het
Cstdc1 T C 2: 148,624,148 (GRCm39) F41L probably damaging Het
D130040H23Rik A G 8: 69,755,525 (GRCm39) N310S probably benign Het
Dalrd3 T C 9: 108,448,284 (GRCm39) I278T probably benign Het
Dbp C A 7: 45,357,700 (GRCm39) D89E probably benign Het
Dennd2c A G 3: 103,039,005 (GRCm39) D51G possibly damaging Het
Dido1 A T 2: 180,330,974 (GRCm39) L158* probably null Het
Disp1 G T 1: 182,869,767 (GRCm39) F884L probably damaging Het
Dmrtb1 T C 4: 107,540,782 (GRCm39) D193G probably damaging Het
Dnah8 A G 17: 30,950,133 (GRCm39) D1984G probably damaging Het
Dpf2 T C 19: 5,952,781 (GRCm39) Y218C possibly damaging Het
Dsg4 C T 18: 20,599,693 (GRCm39) Q770* probably null Het
Efemp1 A T 11: 28,864,696 (GRCm39) Y250F possibly damaging Het
Erbin A T 13: 103,966,703 (GRCm39) I1249N probably benign Het
F5 A G 1: 164,037,044 (GRCm39) K1928E probably benign Het
Fhip1b A G 7: 105,038,143 (GRCm39) V260A probably damaging Het
Gdf11 T A 10: 128,727,314 (GRCm39) I81F probably damaging Het
Gm10518 T A 1: 179,631,483 (GRCm39) probably benign Het
Grb10 G C 11: 11,920,576 (GRCm39) S14* probably null Het
Greb1l A T 18: 10,515,221 (GRCm39) Y562F possibly damaging Het
Gtf2ird1 T C 5: 134,392,788 (GRCm39) E789G probably damaging Het
Hook3 T C 8: 26,528,126 (GRCm39) E588G probably damaging Het
Hpx A G 7: 105,244,311 (GRCm39) S266P probably damaging Het
Hs6st3 A G 14: 120,106,801 (GRCm39) D403G probably damaging Het
Igf2bp1 A G 11: 95,864,996 (GRCm39) V151A possibly damaging Het
Itga11 C T 9: 62,670,093 (GRCm39) T739I probably damaging Het
Kalrn T C 16: 34,010,106 (GRCm39) I702V probably damaging Het
Kif2b C T 11: 91,468,172 (GRCm39) S37N probably damaging Het
Kng2 T A 16: 22,819,325 (GRCm39) D237V probably benign Het
Krtap27-1 C A 16: 88,468,173 (GRCm39) V124L possibly damaging Het
Lig4 A T 8: 10,022,436 (GRCm39) L448Q probably damaging Het
Macf1 C T 4: 123,265,711 (GRCm39) A4821T probably damaging Het
Msh5 T A 17: 35,251,768 (GRCm39) I431F possibly damaging Het
Ndufa10 A G 1: 92,367,614 (GRCm39) Y339H probably damaging Het
Nin T A 12: 70,076,782 (GRCm39) Q1091L probably damaging Het
Nom1 A C 5: 29,651,849 (GRCm39) D729A probably damaging Het
Or52e8 C A 7: 104,624,451 (GRCm39) G247V probably benign Het
P2ry14 A T 3: 59,022,866 (GRCm39) V207E probably damaging Het
Pdss2 A T 10: 43,269,871 (GRCm39) N238I possibly damaging Het
Pkn1 A G 8: 84,398,007 (GRCm39) V795A probably damaging Het
Pla2g6 A C 15: 79,170,964 (GRCm39) L804R probably damaging Het
Poglut1 A T 16: 38,358,267 (GRCm39) probably null Het
Prkcz A T 4: 155,374,167 (GRCm39) V83D probably damaging Het
Prss50 T C 9: 110,690,328 (GRCm39) F157S probably benign Het
Psors1c2 A G 17: 35,845,099 (GRCm39) probably benign Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Pwwp4a G T X: 72,171,261 (GRCm39) G218C probably damaging Het
Rab7 G A 6: 87,981,161 (GRCm39) L174F probably damaging Het
Rapgef4 A G 2: 72,073,083 (GRCm39) T790A probably benign Het
Rb1cc1 G T 1: 6,315,533 (GRCm39) V503L probably damaging Het
Sbf1 T A 15: 89,186,933 (GRCm39) E815V probably damaging Het
Setd3 T A 12: 108,126,526 (GRCm39) E104V probably damaging Het
Slc39a5 A T 10: 128,234,279 (GRCm39) L208Q probably damaging Het
Slc39a5 G T 10: 128,234,280 (GRCm39) L208M probably damaging Het
Slc3a1 T G 17: 85,340,273 (GRCm39) Y232D probably damaging Het
Slc8a1 T A 17: 81,956,541 (GRCm39) S166C probably damaging Het
Stard9 T A 2: 120,532,879 (GRCm39) D3045E probably benign Het
Stk4 C A 2: 163,938,751 (GRCm39) D206E probably damaging Het
Syn3 T C 10: 86,302,846 (GRCm39) D103G probably damaging Het
Tbc1d30 T A 10: 121,115,051 (GRCm39) Y369F probably benign Het
Tenm2 G T 11: 35,938,091 (GRCm39) Y1527* probably null Het
Tfg T C 16: 56,525,988 (GRCm39) K85R possibly damaging Het
Timp3 T C 10: 86,136,749 (GRCm39) L11P probably damaging Het
Tmem144 A T 3: 79,735,018 (GRCm39) probably null Het
Tmtc4 T C 14: 123,158,677 (GRCm39) N682S probably benign Het
Tnks2 C T 19: 36,843,466 (GRCm39) L464F probably damaging Het
Trank1 T C 9: 111,221,107 (GRCm39) F2615L probably benign Het
Trio T C 15: 27,744,223 (GRCm39) K2570E probably damaging Het
Trio T A 15: 27,774,013 (GRCm39) D673V probably damaging Het
Ublcp1 A T 11: 44,356,458 (GRCm39) C87S probably benign Het
Unc13a C T 8: 72,092,412 (GRCm39) E1386K possibly damaging Het
Wdr41 C T 13: 95,155,456 (GRCm39) H404Y probably damaging Het
Zfp280b T C 10: 75,874,328 (GRCm39) L69S probably damaging Het
Zfp346 T C 13: 55,280,121 (GRCm39) S282P probably damaging Het
Zfp579 C A 7: 4,996,520 (GRCm39) E464* probably null Het
Zfp78 T A 7: 6,378,513 (GRCm39) probably null Het
Zswim9 T C 7: 13,003,292 (GRCm39) E186G probably damaging Het
Other mutations in Acan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Acan APN 7 78,747,572 (GRCm39) missense probably benign 0.00
IGL01118:Acan APN 7 78,748,401 (GRCm39) missense possibly damaging 0.78
IGL01145:Acan APN 7 78,749,030 (GRCm39) missense probably damaging 1.00
IGL01308:Acan APN 7 78,748,997 (GRCm39) missense probably damaging 0.98
IGL01520:Acan APN 7 78,734,318 (GRCm39) missense probably damaging 0.96
IGL02069:Acan APN 7 78,742,500 (GRCm39) missense possibly damaging 0.83
IGL02629:Acan APN 7 78,761,727 (GRCm39) missense possibly damaging 0.90
IGL02713:Acan APN 7 78,749,992 (GRCm39) missense possibly damaging 0.90
IGL03001:Acan APN 7 78,761,042 (GRCm39) missense probably damaging 0.99
IGL03081:Acan APN 7 78,748,291 (GRCm39) missense probably benign 0.01
Disproportion UTSW 7 78,742,066 (GRCm39) missense probably damaging 0.98
Hollowleg UTSW 7 78,748,096 (GRCm39) nonsense probably null
Sublimate UTSW 7 78,761,068 (GRCm39) missense probably damaging 0.97
Vacuo UTSW 7 78,738,055 (GRCm39) critical splice donor site probably null
IGL03147:Acan UTSW 7 78,740,804 (GRCm39) missense probably damaging 1.00
R0281:Acan UTSW 7 78,750,033 (GRCm39) missense probably damaging 1.00
R0372:Acan UTSW 7 78,750,349 (GRCm39) missense probably benign 0.00
R0599:Acan UTSW 7 78,761,038 (GRCm39) splice site probably benign
R0827:Acan UTSW 7 78,749,419 (GRCm39) missense probably benign 0.00
R0835:Acan UTSW 7 78,763,980 (GRCm39) missense probably damaging 0.96
R1496:Acan UTSW 7 78,750,552 (GRCm39) missense probably benign 0.06
R1716:Acan UTSW 7 78,731,946 (GRCm39) missense unknown
R1761:Acan UTSW 7 78,743,833 (GRCm39) nonsense probably null
R1848:Acan UTSW 7 78,748,783 (GRCm39) missense probably benign
R2002:Acan UTSW 7 78,750,541 (GRCm39) missense probably damaging 1.00
R2167:Acan UTSW 7 78,749,705 (GRCm39) missense probably benign 0.41
R2189:Acan UTSW 7 78,747,839 (GRCm39) missense probably damaging 1.00
R2303:Acan UTSW 7 78,749,705 (GRCm39) missense probably benign 0.41
R2496:Acan UTSW 7 78,761,065 (GRCm39) missense probably damaging 1.00
R2971:Acan UTSW 7 78,749,447 (GRCm39) missense possibly damaging 0.46
R4004:Acan UTSW 7 78,750,435 (GRCm39) missense probably damaging 1.00
R4669:Acan UTSW 7 78,750,890 (GRCm39) missense probably benign 0.01
R4732:Acan UTSW 7 78,748,357 (GRCm39) missense probably damaging 0.99
R4733:Acan UTSW 7 78,748,357 (GRCm39) missense probably damaging 0.99
R4742:Acan UTSW 7 78,750,517 (GRCm39) missense probably benign 0.41
R4750:Acan UTSW 7 78,742,466 (GRCm39) missense probably damaging 1.00
R5022:Acan UTSW 7 78,742,556 (GRCm39) critical splice donor site probably null
R5122:Acan UTSW 7 78,750,409 (GRCm39) missense probably damaging 0.99
R5190:Acan UTSW 7 78,748,289 (GRCm39) missense probably benign 0.03
R5220:Acan UTSW 7 78,738,045 (GRCm39) missense probably damaging 0.96
R5414:Acan UTSW 7 78,750,736 (GRCm39) missense probably benign 0.00
R5525:Acan UTSW 7 78,749,731 (GRCm39) missense probably benign
R5655:Acan UTSW 7 78,749,791 (GRCm39) missense possibly damaging 0.89
R5662:Acan UTSW 7 78,749,855 (GRCm39) missense possibly damaging 0.78
R5748:Acan UTSW 7 78,739,447 (GRCm39) missense probably damaging 0.98
R5758:Acan UTSW 7 78,750,962 (GRCm39) missense possibly damaging 0.67
R5996:Acan UTSW 7 78,761,068 (GRCm39) missense probably damaging 0.97
R6057:Acan UTSW 7 78,749,530 (GRCm39) missense probably null
R6503:Acan UTSW 7 78,747,580 (GRCm39) missense probably benign 0.04
R6529:Acan UTSW 7 78,739,479 (GRCm39) missense probably benign 0.16
R6887:Acan UTSW 7 78,742,231 (GRCm39) missense probably damaging 1.00
R7041:Acan UTSW 7 78,748,096 (GRCm39) nonsense probably null
R7193:Acan UTSW 7 78,736,090 (GRCm39) missense probably damaging 1.00
R7220:Acan UTSW 7 78,757,896 (GRCm39) missense
R7263:Acan UTSW 7 78,742,066 (GRCm39) missense probably damaging 0.98
R7376:Acan UTSW 7 78,738,055 (GRCm39) critical splice donor site probably null
R7502:Acan UTSW 7 78,743,951 (GRCm39) missense probably damaging 1.00
R7571:Acan UTSW 7 78,736,015 (GRCm39) missense probably damaging 1.00
R7709:Acan UTSW 7 78,739,356 (GRCm39) missense probably damaging 1.00
R7835:Acan UTSW 7 78,749,623 (GRCm39) missense probably benign 0.08
R8051:Acan UTSW 7 78,750,527 (GRCm39) missense probably damaging 0.96
R8131:Acan UTSW 7 78,741,086 (GRCm39) missense possibly damaging 0.92
R8138:Acan UTSW 7 78,748,175 (GRCm39) missense probably benign 0.12
R8324:Acan UTSW 7 78,740,804 (GRCm39) missense probably damaging 1.00
R8482:Acan UTSW 7 78,746,492 (GRCm39) missense probably benign 0.02
R8511:Acan UTSW 7 78,747,683 (GRCm39) missense possibly damaging 0.94
R8716:Acan UTSW 7 78,762,438 (GRCm39) missense probably damaging 1.00
R8753:Acan UTSW 7 78,748,516 (GRCm39) missense possibly damaging 0.83
R8810:Acan UTSW 7 78,749,452 (GRCm39) missense probably damaging 1.00
R8898:Acan UTSW 7 78,750,101 (GRCm39) missense possibly damaging 0.59
R8956:Acan UTSW 7 78,750,713 (GRCm39) missense probably benign 0.00
R9199:Acan UTSW 7 78,736,057 (GRCm39) missense probably damaging 1.00
R9509:Acan UTSW 7 78,740,768 (GRCm39) missense probably damaging 0.96
R9549:Acan UTSW 7 78,742,076 (GRCm39) missense probably damaging 1.00
R9572:Acan UTSW 7 78,748,477 (GRCm39) missense probably damaging 0.99
R9645:Acan UTSW 7 78,749,653 (GRCm39) missense probably benign 0.00
R9742:Acan UTSW 7 78,749,115 (GRCm39) missense probably benign 0.00
RF008:Acan UTSW 7 78,742,148 (GRCm39) missense possibly damaging 0.83
Z1088:Acan UTSW 7 78,761,102 (GRCm39) missense probably benign
Z1088:Acan UTSW 7 78,749,858 (GRCm39) missense probably benign 0.41
Z1088:Acan UTSW 7 78,737,948 (GRCm39) nonsense probably null
Z1176:Acan UTSW 7 78,761,102 (GRCm39) missense probably benign
Z1177:Acan UTSW 7 78,761,102 (GRCm39) missense probably benign
Z1177:Acan UTSW 7 78,749,885 (GRCm39) missense probably damaging 0.99
Z1177:Acan UTSW 7 78,743,918 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGGTGAATGTTGCCATCAGC -3'
(R):5'- GACGCTCAGTGCTTGCTTTG -3'

Sequencing Primer
(F):5'- TCAGCAGCACCATCACAGAGTC -3'
(R):5'- AGTGCTTGCTTTGTTCACATC -3'
Posted On 2014-08-25