Incidental Mutation 'R1985:Camkk2'
ID220437
Institutional Source Beutler Lab
Gene Symbol Camkk2
Ensembl Gene ENSMUSG00000029471
Gene Namecalcium/calmodulin-dependent protein kinase kinase 2, beta
Synonyms6330570N16Rik
MMRRC Submission 039997-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R1985 (G1)
Quality Score197
Status Validated
Chromosome5
Chromosomal Location122731170-122779409 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 122764127 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 40 (S40A)
Ref Sequence ENSEMBL: ENSMUSP00000143730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111668] [ENSMUST00000196742] [ENSMUST00000198257] [ENSMUST00000199599] [ENSMUST00000200109]
Predicted Effect possibly damaging
Transcript: ENSMUST00000111668
AA Change: S40A

PolyPhen 2 Score 0.651 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107297
Gene: ENSMUSG00000029471
AA Change: S40A

DomainStartEndE-ValueType
low complexity region 124 144 N/A INTRINSIC
S_TKc 165 446 1.53e-92 SMART
low complexity region 464 472 N/A INTRINSIC
low complexity region 526 539 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000196742
AA Change: S40A

PolyPhen 2 Score 0.574 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000142812
Gene: ENSMUSG00000029471
AA Change: S40A

DomainStartEndE-ValueType
low complexity region 124 144 N/A INTRINSIC
Pfam:Pkinase 165 206 1.7e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198177
Predicted Effect probably benign
Transcript: ENSMUST00000198257
SMART Domains Protein: ENSMUSP00000143162
Gene: ENSMUSG00000029471

DomainStartEndE-ValueType
low complexity region 27 47 N/A INTRINSIC
Pfam:Pkinase 68 109 3.9e-5 PFAM
low complexity region 111 117 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199179
Predicted Effect possibly damaging
Transcript: ENSMUST00000199599
AA Change: S40A

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199830
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199988
Predicted Effect possibly damaging
Transcript: ENSMUST00000200109
AA Change: S40A

PolyPhen 2 Score 0.651 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000143732
Gene: ENSMUSG00000029471
AA Change: S40A

DomainStartEndE-ValueType
low complexity region 124 144 N/A INTRINSIC
S_TKc 165 446 1.53e-92 SMART
low complexity region 464 472 N/A INTRINSIC
low complexity region 526 539 N/A INTRINSIC
Meta Mutation Damage Score 0.0720 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 94% (76/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the Serine/Threonine protein kinase family, and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. The major isoform of this gene plays a role in the calcium/calmodulin-dependent (CaM) kinase cascade by phosphorylating the downstream kinases CaMK1 and CaMK4. Protein products of this gene also phosphorylate AMP-activated protein kinase (AMPK). This gene has its strongest expression in the brain and influences signalling cascades involved with learning and memory, neuronal differentiation and migration, neurite outgrowth, and synapse formation. Alternative splicing results in multiple transcript variants encoding distinct isoforms. The identified isoforms differ in their ability to undergo autophosphorylation and to phosphorylate downstream kinases. [provided by RefSeq, Jul 2012]
PHENOTYPE: Inactivation of this locus results in impaird long term potentiation and defects in some types of long term memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190007I07Rik T A 10: 82,620,217 T37S possibly damaging Het
AA792892 A T 5: 94,384,072 I272L probably benign Het
Abhd8 C A 8: 71,463,513 probably benign Het
Adam5 A T 8: 24,746,739 D648E probably benign Het
Akr1d1 A G 6: 37,558,401 D240G probably damaging Het
Ankmy2 A G 12: 36,157,364 H3R possibly damaging Het
Anpep A C 7: 79,840,857 probably null Het
Apobr A G 7: 126,587,731 T20A possibly damaging Het
Atp2a2 A T 5: 122,466,836 Y427N probably benign Het
Camp T C 9: 109,848,429 N112S probably benign Het
Cbx7 A G 15: 79,918,390 S229P probably damaging Het
Cnot2 T C 10: 116,527,876 N41S probably damaging Het
Dchs1 A G 7: 105,772,398 F272L possibly damaging Het
Dct T C 14: 118,036,542 K318E probably benign Het
Dhrs11 A C 11: 84,828,807 L31V probably damaging Het
Dnah7a T C 1: 53,503,934 D2359G probably benign Het
Dnajc7 A G 11: 100,590,892 S305P probably benign Het
Dscc1 CTGAATGAAT CTGAAT 15: 55,080,176 probably benign Het
Fam71b T C 11: 46,407,866 *666Q probably null Het
Flnc A G 6: 29,444,416 probably benign Het
Gm7535 A G 17: 17,911,538 probably benign Het
Grtp1 A G 8: 13,179,376 F313L probably damaging Het
Haus6 T C 4: 86,593,609 Y425C possibly damaging Het
Hdac1 T A 4: 129,528,960 N83Y possibly damaging Het
Hdlbp A G 1: 93,431,118 I237T probably damaging Het
Hfm1 A T 5: 106,898,576 D481E probably damaging Het
Hipk3 T C 2: 104,434,435 I737V probably benign Het
Il23r T A 6: 67,490,668 probably null Het
Il24 G A 1: 130,882,531 T196I probably benign Het
Ints3 C T 3: 90,400,303 probably null Het
Kcna6 T C 6: 126,738,510 E472G probably benign Het
Kcnj16 C T 11: 111,025,583 T357M probably benign Het
Kdm4b T A 17: 56,401,302 V957E probably damaging Het
Kif21b G A 1: 136,147,546 D166N probably damaging Het
Klhl11 G T 11: 100,463,244 Q584K probably benign Het
Krt9 A T 11: 100,189,991 M345K probably benign Het
Lgr5 T C 10: 115,495,245 probably benign Het
Lilr4b A T 10: 51,481,735 Q80L possibly damaging Het
Lrrc69 T C 4: 14,708,669 E225G possibly damaging Het
Ly9 A G 1: 171,599,773 S405P probably damaging Het
Myh2 A G 11: 67,180,914 D519G possibly damaging Het
Nav3 G A 10: 109,770,184 probably benign Het
Nfkb1 G A 3: 135,615,349 T215I possibly damaging Het
Ninj2 A T 6: 120,198,639 probably benign Het
Obsl1 A G 1: 75,505,600 C209R probably damaging Het
Olfr1393 T C 11: 49,280,283 I45T probably damaging Het
Olfr314 A C 11: 58,786,384 D50A probably damaging Het
Olfr531 A T 7: 140,400,800 M82K possibly damaging Het
Olfr539 G A 7: 140,667,821 C171Y probably damaging Het
Olfr619 A T 7: 103,603,672 Y6F probably benign Het
Olfr710 A G 7: 106,944,926 I25T probably benign Het
Otud4 G C 8: 79,640,012 R36P probably damaging Het
Pcnt C T 10: 76,380,337 R2239H possibly damaging Het
Pgbd5 T A 8: 124,370,592 M491L probably benign Het
Pitrm1 A T 13: 6,558,184 D316V probably damaging Het
Plod3 A G 5: 136,990,853 probably null Het
Plppr3 A T 10: 79,867,460 Y63* probably null Het
Prickle2 T C 6: 92,411,452 D323G probably damaging Het
Psmd11 A T 11: 80,445,263 I114F probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rbp3 T G 14: 33,956,461 S789A probably benign Het
Rfxap C A 3: 54,807,326 R117L probably damaging Het
Rims2 T A 15: 39,345,314 M171K probably damaging Het
Scin A G 12: 40,133,908 probably null Het
Scn11a A G 9: 119,754,678 S1624P probably benign Het
Slc41a3 G A 6: 90,642,228 V330M probably damaging Het
Slc9c1 A G 16: 45,550,106 I237V probably benign Het
Spag6 A G 2: 18,732,119 I218V probably benign Het
Stam2 T C 2: 52,709,626 T257A possibly damaging Het
Tbc1d24 G A 17: 24,207,964 R318* probably null Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Trpm3 T A 19: 22,926,082 Y1069N possibly damaging Het
Tuba8 A G 6: 121,220,520 D47G probably benign Het
Tulp3 A T 6: 128,326,806 S277T probably benign Het
Wdr7 GTT GT 18: 63,760,583 probably null Het
Ybx2 A G 11: 69,936,468 probably null Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp788 T A 7: 41,650,481 I795N probably damaging Het
Other mutations in Camkk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01866:Camkk2 APN 5 122763950 missense probably damaging 1.00
IGL02321:Camkk2 APN 5 122764127 missense probably damaging 0.96
IGL02619:Camkk2 APN 5 122764235 missense probably damaging 0.98
IGL03356:Camkk2 APN 5 122743874 missense probably damaging 1.00
R0056:Camkk2 UTSW 5 122742198 missense probably damaging 1.00
R0078:Camkk2 UTSW 5 122757559 critical splice donor site probably null
R0344:Camkk2 UTSW 5 122763877 missense probably benign
R1480:Camkk2 UTSW 5 122734278 intron probably null
R1591:Camkk2 UTSW 5 122757558 critical splice donor site probably null
R1816:Camkk2 UTSW 5 122734180 missense probably damaging 1.00
R1960:Camkk2 UTSW 5 122737512 nonsense probably null
R2256:Camkk2 UTSW 5 122746335 missense probably damaging 1.00
R4297:Camkk2 UTSW 5 122745706 critical splice donor site probably null
R4687:Camkk2 UTSW 5 122753724 missense probably damaging 1.00
R5401:Camkk2 UTSW 5 122746335 missense probably damaging 1.00
R5802:Camkk2 UTSW 5 122734244 missense probably damaging 0.99
R6167:Camkk2 UTSW 5 122764124 missense probably damaging 0.96
R6508:Camkk2 UTSW 5 122746319 missense probably damaging 0.96
R7313:Camkk2 UTSW 5 122737511 missense possibly damaging 0.55
R7504:Camkk2 UTSW 5 122746308 missense probably damaging 1.00
R7626:Camkk2 UTSW 5 122764300 splice site probably benign
R7664:Camkk2 UTSW 5 122756582 missense unknown
R7698:Camkk2 UTSW 5 122746419 missense probably damaging 0.96
R7805:Camkk2 UTSW 5 122742212 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ATCTTGCGACCAGAAAGCGG -3'
(R):5'- GTGGAAAGACTCCTCTCCCTATC -3'

Sequencing Primer
(F):5'- GGGACCGGGACTCAGGG -3'
(R):5'- TTTCTGCAGGCAGCTCTG -3'
Posted On2014-08-25