Incidental Mutation 'R2025:Hook3'
ID 220438
Institutional Source Beutler Lab
Gene Symbol Hook3
Ensembl Gene ENSMUSG00000037234
Gene Name hook microtubule tethering protein 3
Synonyms E330005F07Rik, 5830454D03Rik
MMRRC Submission 040034-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2025 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 26511449-26609252 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 26528126 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 588 (E588G)
Ref Sequence ENSEMBL: ENSMUSP00000046788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037182] [ENSMUST00000147613]
AlphaFold Q8BUK6
Predicted Effect probably damaging
Transcript: ENSMUST00000037182
AA Change: E588G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000046788
Gene: ENSMUSG00000037234
AA Change: E588G

DomainStartEndE-ValueType
Pfam:HOOK 12 710 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147613
AA Change: E228G

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000115008
Gene: ENSMUSG00000037234
AA Change: E228G

DomainStartEndE-ValueType
Pfam:HOOK 1 194 1.1e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152144
Predicted Effect probably benign
Transcript: ENSMUST00000211683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211777
Meta Mutation Damage Score 0.0713 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hook proteins are cytosolic coiled-coil proteins that contain conserved N-terminal domains, which attach to microtubules, and more divergent C-terminal domains, which mediate binding to organelles. The Drosophila Hook protein is a component of the endocytic compartment.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 T C 14: 118,790,737 (GRCm39) M757V probably benign Het
Abitram T A 4: 56,805,916 (GRCm39) I138N probably damaging Het
Acan T G 7: 78,750,970 (GRCm39) S1914A probably benign Het
Axin2 T A 11: 108,833,904 (GRCm39) V617D probably damaging Het
Bhlhe22 A G 3: 18,109,975 (GRCm39) S342G probably benign Het
Cald1 AAGAGAGAGAGAGAG AAGAGAGAGAGAG 6: 34,723,108 (GRCm39) probably null Het
Ccdc34 A G 2: 109,862,731 (GRCm39) K179E possibly damaging Het
Clasp1 A G 1: 118,432,629 (GRCm39) T208A probably damaging Het
Crabp1 C T 9: 54,675,752 (GRCm39) R112* probably null Het
Cstdc1 T C 2: 148,624,148 (GRCm39) F41L probably damaging Het
D130040H23Rik A G 8: 69,755,525 (GRCm39) N310S probably benign Het
Dalrd3 T C 9: 108,448,284 (GRCm39) I278T probably benign Het
Dbp C A 7: 45,357,700 (GRCm39) D89E probably benign Het
Dennd2c A G 3: 103,039,005 (GRCm39) D51G possibly damaging Het
Dido1 A T 2: 180,330,974 (GRCm39) L158* probably null Het
Disp1 G T 1: 182,869,767 (GRCm39) F884L probably damaging Het
Dmrtb1 T C 4: 107,540,782 (GRCm39) D193G probably damaging Het
Dnah8 A G 17: 30,950,133 (GRCm39) D1984G probably damaging Het
Dpf2 T C 19: 5,952,781 (GRCm39) Y218C possibly damaging Het
Dsg4 C T 18: 20,599,693 (GRCm39) Q770* probably null Het
Efemp1 A T 11: 28,864,696 (GRCm39) Y250F possibly damaging Het
Erbin A T 13: 103,966,703 (GRCm39) I1249N probably benign Het
F5 A G 1: 164,037,044 (GRCm39) K1928E probably benign Het
Fhip1b A G 7: 105,038,143 (GRCm39) V260A probably damaging Het
Gdf11 T A 10: 128,727,314 (GRCm39) I81F probably damaging Het
Gm10518 T A 1: 179,631,483 (GRCm39) probably benign Het
Grb10 G C 11: 11,920,576 (GRCm39) S14* probably null Het
Greb1l A T 18: 10,515,221 (GRCm39) Y562F possibly damaging Het
Gtf2ird1 T C 5: 134,392,788 (GRCm39) E789G probably damaging Het
Hpx A G 7: 105,244,311 (GRCm39) S266P probably damaging Het
Hs6st3 A G 14: 120,106,801 (GRCm39) D403G probably damaging Het
Igf2bp1 A G 11: 95,864,996 (GRCm39) V151A possibly damaging Het
Itga11 C T 9: 62,670,093 (GRCm39) T739I probably damaging Het
Kalrn T C 16: 34,010,106 (GRCm39) I702V probably damaging Het
Kif2b C T 11: 91,468,172 (GRCm39) S37N probably damaging Het
Kng2 T A 16: 22,819,325 (GRCm39) D237V probably benign Het
Krtap27-1 C A 16: 88,468,173 (GRCm39) V124L possibly damaging Het
Lig4 A T 8: 10,022,436 (GRCm39) L448Q probably damaging Het
Macf1 C T 4: 123,265,711 (GRCm39) A4821T probably damaging Het
Msh5 T A 17: 35,251,768 (GRCm39) I431F possibly damaging Het
Ndufa10 A G 1: 92,367,614 (GRCm39) Y339H probably damaging Het
Nin T A 12: 70,076,782 (GRCm39) Q1091L probably damaging Het
Nom1 A C 5: 29,651,849 (GRCm39) D729A probably damaging Het
Or52e8 C A 7: 104,624,451 (GRCm39) G247V probably benign Het
P2ry14 A T 3: 59,022,866 (GRCm39) V207E probably damaging Het
Pdss2 A T 10: 43,269,871 (GRCm39) N238I possibly damaging Het
Pkn1 A G 8: 84,398,007 (GRCm39) V795A probably damaging Het
Pla2g6 A C 15: 79,170,964 (GRCm39) L804R probably damaging Het
Poglut1 A T 16: 38,358,267 (GRCm39) probably null Het
Prkcz A T 4: 155,374,167 (GRCm39) V83D probably damaging Het
Prss50 T C 9: 110,690,328 (GRCm39) F157S probably benign Het
Psors1c2 A G 17: 35,845,099 (GRCm39) probably benign Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Pwwp4a G T X: 72,171,261 (GRCm39) G218C probably damaging Het
Rab7 G A 6: 87,981,161 (GRCm39) L174F probably damaging Het
Rapgef4 A G 2: 72,073,083 (GRCm39) T790A probably benign Het
Rb1cc1 G T 1: 6,315,533 (GRCm39) V503L probably damaging Het
Sbf1 T A 15: 89,186,933 (GRCm39) E815V probably damaging Het
Setd3 T A 12: 108,126,526 (GRCm39) E104V probably damaging Het
Slc39a5 A T 10: 128,234,279 (GRCm39) L208Q probably damaging Het
Slc39a5 G T 10: 128,234,280 (GRCm39) L208M probably damaging Het
Slc3a1 T G 17: 85,340,273 (GRCm39) Y232D probably damaging Het
Slc8a1 T A 17: 81,956,541 (GRCm39) S166C probably damaging Het
Stard9 T A 2: 120,532,879 (GRCm39) D3045E probably benign Het
Stk4 C A 2: 163,938,751 (GRCm39) D206E probably damaging Het
Syn3 T C 10: 86,302,846 (GRCm39) D103G probably damaging Het
Tbc1d30 T A 10: 121,115,051 (GRCm39) Y369F probably benign Het
Tenm2 G T 11: 35,938,091 (GRCm39) Y1527* probably null Het
Tfg T C 16: 56,525,988 (GRCm39) K85R possibly damaging Het
Timp3 T C 10: 86,136,749 (GRCm39) L11P probably damaging Het
Tmem144 A T 3: 79,735,018 (GRCm39) probably null Het
Tmtc4 T C 14: 123,158,677 (GRCm39) N682S probably benign Het
Tnks2 C T 19: 36,843,466 (GRCm39) L464F probably damaging Het
Trank1 T C 9: 111,221,107 (GRCm39) F2615L probably benign Het
Trio T C 15: 27,744,223 (GRCm39) K2570E probably damaging Het
Trio T A 15: 27,774,013 (GRCm39) D673V probably damaging Het
Ublcp1 A T 11: 44,356,458 (GRCm39) C87S probably benign Het
Unc13a C T 8: 72,092,412 (GRCm39) E1386K possibly damaging Het
Wdr41 C T 13: 95,155,456 (GRCm39) H404Y probably damaging Het
Zfp280b T C 10: 75,874,328 (GRCm39) L69S probably damaging Het
Zfp346 T C 13: 55,280,121 (GRCm39) S282P probably damaging Het
Zfp579 C A 7: 4,996,520 (GRCm39) E464* probably null Het
Zfp78 T A 7: 6,378,513 (GRCm39) probably null Het
Zswim9 T C 7: 13,003,292 (GRCm39) E186G probably damaging Het
Other mutations in Hook3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00695:Hook3 APN 8 26,549,278 (GRCm39) missense possibly damaging 0.46
IGL01066:Hook3 APN 8 26,538,326 (GRCm39) missense probably damaging 1.00
IGL01145:Hook3 APN 8 26,549,372 (GRCm39) missense probably benign 0.00
IGL01514:Hook3 APN 8 26,578,217 (GRCm39) missense possibly damaging 0.69
IGL01727:Hook3 APN 8 26,560,187 (GRCm39) missense probably benign 0.00
IGL01832:Hook3 APN 8 26,562,393 (GRCm39) missense possibly damaging 0.87
IGL01874:Hook3 APN 8 26,529,760 (GRCm39) missense possibly damaging 0.71
IGL01931:Hook3 APN 8 26,578,083 (GRCm39) splice site probably benign
IGL01948:Hook3 APN 8 26,549,340 (GRCm39) missense possibly damaging 0.95
IGL02209:Hook3 APN 8 26,560,293 (GRCm39) missense probably damaging 0.99
IGL02675:Hook3 APN 8 26,551,462 (GRCm39) missense possibly damaging 0.64
IGL02750:Hook3 APN 8 26,585,782 (GRCm39) splice site probably benign
Rufio UTSW 8 26,524,968 (GRCm39) nonsense probably null
R0384:Hook3 UTSW 8 26,534,263 (GRCm39) splice site probably null
R0600:Hook3 UTSW 8 26,609,014 (GRCm39) missense probably benign
R1037:Hook3 UTSW 8 26,562,378 (GRCm39) missense possibly damaging 0.92
R1413:Hook3 UTSW 8 26,528,134 (GRCm39) missense probably damaging 0.98
R1563:Hook3 UTSW 8 26,600,780 (GRCm39) missense probably benign 0.06
R1767:Hook3 UTSW 8 26,561,084 (GRCm39) critical splice donor site probably null
R1806:Hook3 UTSW 8 26,558,687 (GRCm39) missense probably damaging 1.00
R2026:Hook3 UTSW 8 26,528,126 (GRCm39) missense probably damaging 0.96
R2027:Hook3 UTSW 8 26,528,126 (GRCm39) missense probably damaging 0.96
R2091:Hook3 UTSW 8 26,549,422 (GRCm39) splice site probably benign
R2153:Hook3 UTSW 8 26,560,225 (GRCm39) missense probably damaging 1.00
R2184:Hook3 UTSW 8 26,609,011 (GRCm39) missense probably benign 0.00
R4586:Hook3 UTSW 8 26,522,039 (GRCm39) missense probably damaging 0.98
R4863:Hook3 UTSW 8 26,528,057 (GRCm39) missense probably damaging 1.00
R4971:Hook3 UTSW 8 26,572,607 (GRCm39) missense probably benign 0.22
R5023:Hook3 UTSW 8 26,522,047 (GRCm39) frame shift probably null
R5026:Hook3 UTSW 8 26,600,785 (GRCm39) missense probably damaging 0.98
R5068:Hook3 UTSW 8 26,585,785 (GRCm39) critical splice donor site probably null
R5253:Hook3 UTSW 8 26,562,319 (GRCm39) missense probably benign
R5383:Hook3 UTSW 8 26,609,017 (GRCm39) missense probably benign 0.01
R5437:Hook3 UTSW 8 26,551,450 (GRCm39) missense probably benign 0.05
R5528:Hook3 UTSW 8 26,562,321 (GRCm39) missense probably damaging 1.00
R5551:Hook3 UTSW 8 26,558,639 (GRCm39) missense possibly damaging 0.75
R5846:Hook3 UTSW 8 26,534,355 (GRCm39) intron probably benign
R5907:Hook3 UTSW 8 26,534,306 (GRCm39) intron probably benign
R6082:Hook3 UTSW 8 26,600,813 (GRCm39) missense probably benign 0.00
R6124:Hook3 UTSW 8 26,549,300 (GRCm39) missense probably benign 0.20
R6301:Hook3 UTSW 8 26,524,968 (GRCm39) nonsense probably null
R6314:Hook3 UTSW 8 26,578,136 (GRCm39) missense probably benign
R6448:Hook3 UTSW 8 26,583,692 (GRCm39) missense probably benign 0.02
R6810:Hook3 UTSW 8 26,522,450 (GRCm39) splice site probably null
R7168:Hook3 UTSW 8 26,561,114 (GRCm39) missense probably benign 0.02
R7856:Hook3 UTSW 8 26,525,249 (GRCm39) missense probably damaging 1.00
R7988:Hook3 UTSW 8 26,563,675 (GRCm39) missense probably benign 0.02
R8079:Hook3 UTSW 8 26,578,086 (GRCm39) critical splice donor site probably null
R9121:Hook3 UTSW 8 26,525,195 (GRCm39) missense probably damaging 1.00
R9223:Hook3 UTSW 8 26,522,552 (GRCm39) missense
R9244:Hook3 UTSW 8 26,561,084 (GRCm39) critical splice donor site probably null
R9246:Hook3 UTSW 8 26,562,319 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGCTTAGAAGGCTTCTTTGATGA -3'
(R):5'- CTCACCTGGAGCTGCTTCT -3'

Sequencing Primer
(F):5'- CTTAGAAGGCTTCTTTGATGATTTTC -3'
(R):5'- CTGAAGGCAGCTACAGTGTACTTAC -3'
Posted On 2014-08-25