Mutagenetix > Incidental Mutation

Incidental Mutation 'R2025:Hook3'

220438

Institutional Source

Beutler Lab

Gene Symbol

Hook3

Ensembl Gene

ENSMUSG00000037234

Gene Name

hook microtubule tethering protein 3

Synonyms

E330005F07Rik, 5830454D03Rik

MMRRC Submission

040034-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2025 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

26021421-26119224 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 26038098 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 588 (E588G)

Ref Sequence

ENSEMBL: ENSMUSP00000046788 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037182] [ENSMUST00000147613]

AlphaFold

Q8BUK6

Predicted Effect

probably damaging
Transcript: ENSMUST00000037182
AA Change: E588G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000046788
Gene: ENSMUSG00000037234
AA Change: E588G

Domain	Start	End	E-Value	Type
Pfam:HOOK	12	710	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000147613
AA Change: E228G

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000115008
Gene: ENSMUSG00000037234
AA Change: E228G

Domain	Start	End	E-Value	Type
Pfam:HOOK	1	194	1.1e-75	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152144

Predicted Effect

probably benign
Transcript: ENSMUST00000211683

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211777

Meta Mutation Damage Score

0.0713

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hook proteins are cytosolic coiled-coil proteins that contain conserved N-terminal domains, which attach to microtubules, and more divergent C-terminal domains, which mediate binding to organelles. The Drosophila Hook protein is a component of the endocytic compartment.[supplied by OMIM, Apr 2004]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8030411F24Rik	T	C	2: 148,782,228	F41L	probably damaging	Het
Abcc4	T	C	14: 118,553,325	M757V	probably benign	Het
Acan	T	G	7: 79,101,222	S1914A	probably benign	Het
Axin2	T	A	11: 108,943,078	V617D	probably damaging	Het
Bhlhe22	A	G	3: 18,055,811	S342G	probably benign	Het
Cald1	AAGAGAGAGAGAGAG	AAGAGAGAGAGAG	6: 34,746,173		probably null	Het
Ccdc34	A	G	2: 110,032,386	K179E	possibly damaging	Het
Clasp1	A	G	1: 118,504,899	T208A	probably damaging	Het
Crabp1	C	T	9: 54,768,468	R112*	probably null	Het
D130040H23Rik	A	G	8: 69,302,873	N310S	probably benign	Het
Dalrd3	T	C	9: 108,571,085	I278T	probably benign	Het
Dbp	C	A	7: 45,708,276	D89E	probably benign	Het
Dennd2c	A	G	3: 103,131,689	D51G	possibly damaging	Het
Dido1	A	T	2: 180,689,181	L158*	probably null	Het
Disp1	G	T	1: 183,088,203	F884L	probably damaging	Het
Dmrtb1	T	C	4: 107,683,585	D193G	probably damaging	Het
Dnah8	A	G	17: 30,731,159	D1984G	probably damaging	Het
Dpf2	T	C	19: 5,902,753	Y218C	possibly damaging	Het
Dsg4	C	T	18: 20,466,636	Q770*	probably null	Het
Efemp1	A	T	11: 28,914,696	Y250F	possibly damaging	Het
Erbin	A	T	13: 103,830,195	I1249N	probably benign	Het
F5	A	G	1: 164,209,475	K1928E	probably benign	Het
Fam160a2	A	G	7: 105,388,936	V260A	probably damaging	Het
Fam206a	T	A	4: 56,805,916	I138N	probably damaging	Het
Gdf11	T	A	10: 128,891,445	I81F	probably damaging	Het
Gm10518	T	A	1: 179,803,918		probably benign	Het
Gm14685	G	T	X: 73,127,655	G218C	probably damaging	Het
Grb10	G	C	11: 11,970,576	S14*	probably null	Het
Greb1l	A	T	18: 10,515,221	Y562F	possibly damaging	Het
Gtf2ird1	T	C	5: 134,363,934	E789G	probably damaging	Het
Hpx	A	G	7: 105,595,104	S266P	probably damaging	Het
Hs6st3	A	G	14: 119,869,389	D403G	probably damaging	Het
Igf2bp1	A	G	11: 95,974,170	V151A	possibly damaging	Het
Itga11	C	T	9: 62,762,811	T739I	probably damaging	Het
Kalrn	T	C	16: 34,189,736	I702V	probably damaging	Het
Kif2b	C	T	11: 91,577,346	S37N	probably damaging	Het
Kng2	T	A	16: 23,000,575	D237V	probably benign	Het
Krtap27-1	C	A	16: 88,671,285	V124L	possibly damaging	Het
Lig4	A	T	8: 9,972,436	L448Q	probably damaging	Het
Macf1	C	T	4: 123,371,918	A4821T	probably damaging	Het
Msh5	T	A	17: 35,032,792	I431F	possibly damaging	Het
Ndufa10	A	G	1: 92,439,892	Y339H	probably damaging	Het
Nin	T	A	12: 70,030,008	Q1091L	probably damaging	Het
Nom1	A	C	5: 29,446,851	D729A	probably damaging	Het
Olfr671	C	A	7: 104,975,244	G247V	probably benign	Het
P2ry14	A	T	3: 59,115,445	V207E	probably damaging	Het
Pdss2	A	T	10: 43,393,875	N238I	possibly damaging	Het
Pkn1	A	G	8: 83,671,378	V795A	probably damaging	Het
Pla2g6	A	C	15: 79,286,764	L804R	probably damaging	Het
Poglut1	A	T	16: 38,537,905		probably null	Het
Prkcz	A	T	4: 155,289,710	V83D	probably damaging	Het
Prss50	T	C	9: 110,861,260	F157S	probably benign	Het
Psors1c2	A	G	17: 35,534,202		probably benign	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rab7	G	A	6: 88,004,179	L174F	probably damaging	Het
Rapgef4	A	G	2: 72,242,739	T790A	probably benign	Het
Rb1cc1	G	T	1: 6,245,309	V503L	probably damaging	Het
Sbf1	T	A	15: 89,302,730	E815V	probably damaging	Het
Setd3	T	A	12: 108,160,267	E104V	probably damaging	Het
Slc39a5	A	T	10: 128,398,410	L208Q	probably damaging	Het
Slc39a5	G	T	10: 128,398,411	L208M	probably damaging	Het
Slc3a1	T	G	17: 85,032,845	Y232D	probably damaging	Het
Slc8a1	T	A	17: 81,649,112	S166C	probably damaging	Het
Stard9	T	A	2: 120,702,398	D3045E	probably benign	Het
Stk4	C	A	2: 164,096,831	D206E	probably damaging	Het
Syn3	T	C	10: 86,466,982	D103G	probably damaging	Het
Tbc1d30	T	A	10: 121,279,146	Y369F	probably benign	Het
Tenm2	G	T	11: 36,047,264	Y1527*	probably null	Het
Tfg	T	C	16: 56,705,625	K85R	possibly damaging	Het
Timp3	T	C	10: 86,300,885	L11P	probably damaging	Het
Tmem144	A	T	3: 79,827,711		probably null	Het
Tmtc4	T	C	14: 122,921,265	N682S	probably benign	Het
Tnks2	C	T	19: 36,866,066	L464F	probably damaging	Het
Trank1	T	C	9: 111,392,039	F2615L	probably benign	Het
Trio	T	C	15: 27,744,137	K2570E	probably damaging	Het
Trio	T	A	15: 27,773,927	D673V	probably damaging	Het
Ublcp1	A	T	11: 44,465,631	C87S	probably benign	Het
Unc13a	C	T	8: 71,639,768	E1386K	possibly damaging	Het
Wdr41	C	T	13: 95,018,948	H404Y	probably damaging	Het
Zfp280b	T	C	10: 76,038,494	L69S	probably damaging	Het
Zfp346	T	C	13: 55,132,308	S282P	probably damaging	Het
Zfp579	C	A	7: 4,993,521	E464*	probably null	Het
Zfp78	T	A	7: 6,375,514		probably null	Het
Zswim9	T	C	7: 13,269,366	E186G	probably damaging	Het

Other mutations in Hook3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00695:Hook3	APN	8	26059250	missense	possibly damaging	0.46
IGL01066:Hook3	APN	8	26048298	missense	probably damaging	1.00
IGL01145:Hook3	APN	8	26059344	missense	probably benign	0.00
IGL01514:Hook3	APN	8	26088189	missense	possibly damaging	0.69
IGL01727:Hook3	APN	8	26070159	missense	probably benign	0.00
IGL01832:Hook3	APN	8	26072365	missense	possibly damaging	0.87
IGL01874:Hook3	APN	8	26039732	missense	possibly damaging	0.71
IGL01931:Hook3	APN	8	26088055	splice site	probably benign
IGL01948:Hook3	APN	8	26059312	missense	possibly damaging	0.95
IGL02209:Hook3	APN	8	26070265	missense	probably damaging	0.99
IGL02675:Hook3	APN	8	26061434	missense	possibly damaging	0.64
IGL02750:Hook3	APN	8	26095754	splice site	probably benign
Rufio	UTSW	8	26034940	nonsense	probably null
R0384:Hook3	UTSW	8	26044235	splice site	probably null
R0600:Hook3	UTSW	8	26118986	missense	probably benign
R1037:Hook3	UTSW	8	26072350	missense	possibly damaging	0.92
R1413:Hook3	UTSW	8	26038106	missense	probably damaging	0.98
R1563:Hook3	UTSW	8	26110752	missense	probably benign	0.06
R1767:Hook3	UTSW	8	26071056	critical splice donor site	probably null
R1806:Hook3	UTSW	8	26068659	missense	probably damaging	1.00
R2026:Hook3	UTSW	8	26038098	missense	probably damaging	0.96
R2027:Hook3	UTSW	8	26038098	missense	probably damaging	0.96
R2091:Hook3	UTSW	8	26059394	splice site	probably benign
R2153:Hook3	UTSW	8	26070197	missense	probably damaging	1.00
R2184:Hook3	UTSW	8	26118983	missense	probably benign	0.00
R4586:Hook3	UTSW	8	26032011	missense	probably damaging	0.98
R4863:Hook3	UTSW	8	26038029	missense	probably damaging	1.00
R4971:Hook3	UTSW	8	26082579	missense	probably benign	0.22
R5023:Hook3	UTSW	8	26032019	frame shift	probably null
R5026:Hook3	UTSW	8	26110757	missense	probably damaging	0.98
R5068:Hook3	UTSW	8	26095757	critical splice donor site	probably null
R5253:Hook3	UTSW	8	26072291	missense	probably benign
R5383:Hook3	UTSW	8	26118989	missense	probably benign	0.01
R5437:Hook3	UTSW	8	26061422	missense	probably benign	0.05
R5528:Hook3	UTSW	8	26072293	missense	probably damaging	1.00
R5551:Hook3	UTSW	8	26068611	missense	possibly damaging	0.75
R5846:Hook3	UTSW	8	26044327	intron	probably benign
R5907:Hook3	UTSW	8	26044278	intron	probably benign
R6082:Hook3	UTSW	8	26110785	missense	probably benign	0.00
R6124:Hook3	UTSW	8	26059272	missense	probably benign	0.20
R6301:Hook3	UTSW	8	26034940	nonsense	probably null
R6314:Hook3	UTSW	8	26088108	missense	probably benign
R6448:Hook3	UTSW	8	26093664	missense	probably benign	0.02
R6810:Hook3	UTSW	8	26032422	splice site	probably null
R7168:Hook3	UTSW	8	26071086	missense	probably benign	0.02
R7856:Hook3	UTSW	8	26035221	missense	probably damaging	1.00
R7988:Hook3	UTSW	8	26073647	missense	probably benign	0.02
R8079:Hook3	UTSW	8	26088058	critical splice donor site	probably null
R9121:Hook3	UTSW	8	26035167	missense	probably damaging	1.00
R9223:Hook3	UTSW	8	26032524	missense
R9244:Hook3	UTSW	8	26071056	critical splice donor site	probably null
R9246:Hook3	UTSW	8	26072291	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CTGCTTAGAAGGCTTCTTTGATGA -3'
(R):5'- CTCACCTGGAGCTGCTTCT -3'

Sequencing Primer
(F):5'- CTTAGAAGGCTTCTTTGATGATTTTC -3'
(R):5'- CTGAAGGCAGCTACAGTGTACTTAC -3'

Posted On

2014-08-25