Incidental Mutation 'R1985:Akr1d1'
ID220443
Institutional Source Beutler Lab
Gene Symbol Akr1d1
Ensembl Gene ENSMUSG00000038641
Gene Namealdo-keto reductase family 1, member D1
Synonyms
MMRRC Submission 039997-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1985 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location37530173-37568815 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37558401 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 240 (D240G)
Ref Sequence ENSEMBL: ENSMUSP00000048830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040987]
Predicted Effect probably damaging
Transcript: ENSMUST00000040987
AA Change: D240G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048830
Gene: ENSMUSG00000038641
AA Change: D240G

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 20 303 2.7e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123648
Meta Mutation Damage Score 0.6821 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 94% (76/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The enzyme encoded by this gene is responsible for the catalysis of the 5-beta-reduction of bile acid intermediates and steroid hormones carrying a delta(4)-3-one structure. Deficiency of this enzyme may contribute to hepatic dysfunction. Three transcript variants encoding different isoforms have been found for this gene. Other variants may be present, but their full-length natures have not been determined yet. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190007I07Rik T A 10: 82,620,217 T37S possibly damaging Het
AA792892 A T 5: 94,384,072 I272L probably benign Het
Abhd8 C A 8: 71,463,513 probably benign Het
Adam5 A T 8: 24,746,739 D648E probably benign Het
Ankmy2 A G 12: 36,157,364 H3R possibly damaging Het
Anpep A C 7: 79,840,857 probably null Het
Apobr A G 7: 126,587,731 T20A possibly damaging Het
Atp2a2 A T 5: 122,466,836 Y427N probably benign Het
Camkk2 A C 5: 122,764,127 S40A possibly damaging Het
Camp T C 9: 109,848,429 N112S probably benign Het
Cbx7 A G 15: 79,918,390 S229P probably damaging Het
Cnot2 T C 10: 116,527,876 N41S probably damaging Het
Dchs1 A G 7: 105,772,398 F272L possibly damaging Het
Dct T C 14: 118,036,542 K318E probably benign Het
Dhrs11 A C 11: 84,828,807 L31V probably damaging Het
Dnah7a T C 1: 53,503,934 D2359G probably benign Het
Dnajc7 A G 11: 100,590,892 S305P probably benign Het
Dscc1 CTGAATGAAT CTGAAT 15: 55,080,176 probably benign Het
Fam71b T C 11: 46,407,866 *666Q probably null Het
Flnc A G 6: 29,444,416 probably benign Het
Gm7535 A G 17: 17,911,538 probably benign Het
Grtp1 A G 8: 13,179,376 F313L probably damaging Het
Haus6 T C 4: 86,593,609 Y425C possibly damaging Het
Hdac1 T A 4: 129,528,960 N83Y possibly damaging Het
Hdlbp A G 1: 93,431,118 I237T probably damaging Het
Hfm1 A T 5: 106,898,576 D481E probably damaging Het
Hipk3 T C 2: 104,434,435 I737V probably benign Het
Il23r T A 6: 67,490,668 probably null Het
Il24 G A 1: 130,882,531 T196I probably benign Het
Ints3 C T 3: 90,400,303 probably null Het
Kcna6 T C 6: 126,738,510 E472G probably benign Het
Kcnj16 C T 11: 111,025,583 T357M probably benign Het
Kdm4b T A 17: 56,401,302 V957E probably damaging Het
Kif21b G A 1: 136,147,546 D166N probably damaging Het
Klhl11 G T 11: 100,463,244 Q584K probably benign Het
Krt9 A T 11: 100,189,991 M345K probably benign Het
Lgr5 T C 10: 115,495,245 probably benign Het
Lilr4b A T 10: 51,481,735 Q80L possibly damaging Het
Lrrc69 T C 4: 14,708,669 E225G possibly damaging Het
Ly9 A G 1: 171,599,773 S405P probably damaging Het
Myh2 A G 11: 67,180,914 D519G possibly damaging Het
Nav3 G A 10: 109,770,184 probably benign Het
Nfkb1 G A 3: 135,615,349 T215I possibly damaging Het
Ninj2 A T 6: 120,198,639 probably benign Het
Obsl1 A G 1: 75,505,600 C209R probably damaging Het
Olfr1393 T C 11: 49,280,283 I45T probably damaging Het
Olfr314 A C 11: 58,786,384 D50A probably damaging Het
Olfr531 A T 7: 140,400,800 M82K possibly damaging Het
Olfr539 G A 7: 140,667,821 C171Y probably damaging Het
Olfr619 A T 7: 103,603,672 Y6F probably benign Het
Olfr710 A G 7: 106,944,926 I25T probably benign Het
Otud4 G C 8: 79,640,012 R36P probably damaging Het
Pcnt C T 10: 76,380,337 R2239H possibly damaging Het
Pgbd5 T A 8: 124,370,592 M491L probably benign Het
Pitrm1 A T 13: 6,558,184 D316V probably damaging Het
Plod3 A G 5: 136,990,853 probably null Het
Plppr3 A T 10: 79,867,460 Y63* probably null Het
Prickle2 T C 6: 92,411,452 D323G probably damaging Het
Psmd11 A T 11: 80,445,263 I114F probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rbp3 T G 14: 33,956,461 S789A probably benign Het
Rfxap C A 3: 54,807,326 R117L probably damaging Het
Rims2 T A 15: 39,345,314 M171K probably damaging Het
Scin A G 12: 40,133,908 probably null Het
Scn11a A G 9: 119,754,678 S1624P probably benign Het
Slc41a3 G A 6: 90,642,228 V330M probably damaging Het
Slc9c1 A G 16: 45,550,106 I237V probably benign Het
Spag6 A G 2: 18,732,119 I218V probably benign Het
Stam2 T C 2: 52,709,626 T257A possibly damaging Het
Tbc1d24 G A 17: 24,207,964 R318* probably null Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Trpm3 T A 19: 22,926,082 Y1069N possibly damaging Het
Tuba8 A G 6: 121,220,520 D47G probably benign Het
Tulp3 A T 6: 128,326,806 S277T probably benign Het
Wdr7 GTT GT 18: 63,760,583 probably null Het
Ybx2 A G 11: 69,936,468 probably null Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp788 T A 7: 41,650,481 I795N probably damaging Het
Other mutations in Akr1d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01686:Akr1d1 APN 6 37530243 start gained probably benign
IGL01927:Akr1d1 APN 6 37564459 missense probably benign 0.35
IGL02376:Akr1d1 APN 6 37530285 missense probably damaging 0.99
IGL02488:Akr1d1 APN 6 37567160 missense probably benign 0.00
IGL02490:Akr1d1 APN 6 37558488 missense probably damaging 1.00
IGL02685:Akr1d1 APN 6 37530343 splice site probably benign
R0963:Akr1d1 UTSW 6 37530274 missense probably damaging 0.98
R1962:Akr1d1 UTSW 6 37536048 missense probably benign 0.01
R4082:Akr1d1 UTSW 6 37557489 missense probably damaging 1.00
R4736:Akr1d1 UTSW 6 37557600 critical splice donor site probably null
R4850:Akr1d1 UTSW 6 37554587 unclassified probably null
R4860:Akr1d1 UTSW 6 37564491 missense probably damaging 1.00
R4860:Akr1d1 UTSW 6 37564491 missense probably damaging 1.00
R4883:Akr1d1 UTSW 6 37558401 missense possibly damaging 0.84
R5226:Akr1d1 UTSW 6 37536014 splice site probably null
R6024:Akr1d1 UTSW 6 37558482 missense probably benign 0.01
R6451:Akr1d1 UTSW 6 37550215 missense probably benign 0.06
R7538:Akr1d1 UTSW 6 37536108 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- GATTCCATGATTGGTTACACTCAGAG -3'
(R):5'- TTCAGAACACTCTCCAGGGTG -3'

Sequencing Primer
(F):5'- GGTTACACTCAGAGAACTTGACTAG -3'
(R):5'- AACACTCTCCAGGGTGTCAGAG -3'
Posted On2014-08-25