Incidental Mutation 'R2025:Unc13a'
ID220444
Institutional Source Beutler Lab
Gene Symbol Unc13a
Ensembl Gene ENSMUSG00000034799
Gene Nameunc-13 homolog A (C. elegans)
Synonyms2410078G03Rik, Munc13-1
MMRRC Submission 040034-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2025 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location71624417-71671757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 71639768 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1386 (E1386K)
Ref Sequence ENSEMBL: ENSMUSP00000135189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030170] [ENSMUST00000177517]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030170
AA Change: E1386K

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030170
Gene: ENSMUSG00000034799
AA Change: E1386K

DomainStartEndE-ValueType
C2 3 94 5.23e-10 SMART
low complexity region 187 202 N/A INTRINSIC
low complexity region 264 277 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
coiled coil region 321 359 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 435 450 N/A INTRINSIC
PDB:2KDU|B 454 488 3e-16 PDB
C1 563 612 3.93e-18 SMART
C2 686 793 5.86e-22 SMART
DUF1041 1002 1111 1.6e-56 SMART
Pfam:Membr_traf_MHD 1355 1520 6.3e-53 PFAM
C2 1555 1661 5.03e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175909
Predicted Effect probably benign
Transcript: ENSMUST00000176127
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177032
Predicted Effect possibly damaging
Transcript: ENSMUST00000177517
AA Change: E1386K

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135189
Gene: ENSMUSG00000034799
AA Change: E1386K

DomainStartEndE-ValueType
C2 3 94 5.23e-10 SMART
low complexity region 187 202 N/A INTRINSIC
low complexity region 264 277 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
coiled coil region 321 359 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 435 450 N/A INTRINSIC
PDB:2KDU|B 454 488 3e-16 PDB
C1 563 612 3.93e-18 SMART
C2 686 793 5.86e-22 SMART
DUF1041 1002 1111 1.6e-56 SMART
Pfam:Membr_traf_MHD 1355 1520 6.7e-53 PFAM
C2 1574 1680 5.03e-12 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the UNC13 family. UNC13 proteins bind to phorbol esters and diacylglycerol and play important roles in neurotransmitter release at synapses. Single nucleotide polymorphisms in this gene may be associated with sporadic amyotrophic lateral sclerosis. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutant mice do not feed and die within hours of birth and synaptic vesicle maturation is impaired. Mice homozygous for a knock-in allele exhibit slower rate of synaptic vesicle replenishment, aberrant short-term depression and reduced recoveryfrom synaptic depression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik T C 2: 148,782,228 F41L probably damaging Het
Abcc4 T C 14: 118,553,325 M757V probably benign Het
Acan T G 7: 79,101,222 S1914A probably benign Het
Axin2 T A 11: 108,943,078 V617D probably damaging Het
Bhlhe22 A G 3: 18,055,811 S342G probably benign Het
Cald1 AAGAGAGAGAGAGAG AAGAGAGAGAGAG 6: 34,746,173 probably null Het
Ccdc34 A G 2: 110,032,386 K179E possibly damaging Het
Clasp1 A G 1: 118,504,899 T208A probably damaging Het
Crabp1 C T 9: 54,768,468 R112* probably null Het
D130040H23Rik A G 8: 69,302,873 N310S probably benign Het
Dalrd3 T C 9: 108,571,085 I278T probably benign Het
Dbp C A 7: 45,708,276 D89E probably benign Het
Dennd2c A G 3: 103,131,689 D51G possibly damaging Het
Dido1 A T 2: 180,689,181 L158* probably null Het
Disp1 G T 1: 183,088,203 F884L probably damaging Het
Dmrtb1 T C 4: 107,683,585 D193G probably damaging Het
Dnah8 A G 17: 30,731,159 D1984G probably damaging Het
Dpf2 T C 19: 5,902,753 Y218C possibly damaging Het
Dsg4 C T 18: 20,466,636 Q770* probably null Het
Efemp1 A T 11: 28,914,696 Y250F possibly damaging Het
Erbin A T 13: 103,830,195 I1249N probably benign Het
F5 A G 1: 164,209,475 K1928E probably benign Het
Fam160a2 A G 7: 105,388,936 V260A probably damaging Het
Fam206a T A 4: 56,805,916 I138N probably damaging Het
Gdf11 T A 10: 128,891,445 I81F probably damaging Het
Gm10518 T A 1: 179,803,918 probably benign Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Grb10 G C 11: 11,970,576 S14* probably null Het
Greb1l A T 18: 10,515,221 Y562F possibly damaging Het
Gtf2ird1 T C 5: 134,363,934 E789G probably damaging Het
Hook3 T C 8: 26,038,098 E588G probably damaging Het
Hpx A G 7: 105,595,104 S266P probably damaging Het
Hs6st3 A G 14: 119,869,389 D403G probably damaging Het
Igf2bp1 A G 11: 95,974,170 V151A possibly damaging Het
Itga11 C T 9: 62,762,811 T739I probably damaging Het
Kalrn T C 16: 34,189,736 I702V probably damaging Het
Kif2b C T 11: 91,577,346 S37N probably damaging Het
Kng2 T A 16: 23,000,575 D237V probably benign Het
Krtap27-1 C A 16: 88,671,285 V124L possibly damaging Het
Lig4 A T 8: 9,972,436 L448Q probably damaging Het
Macf1 C T 4: 123,371,918 A4821T probably damaging Het
Msh5 T A 17: 35,032,792 I431F possibly damaging Het
Ndufa10 A G 1: 92,439,892 Y339H probably damaging Het
Nin T A 12: 70,030,008 Q1091L probably damaging Het
Nom1 A C 5: 29,446,851 D729A probably damaging Het
Olfr671 C A 7: 104,975,244 G247V probably benign Het
P2ry14 A T 3: 59,115,445 V207E probably damaging Het
Pdss2 A T 10: 43,393,875 N238I possibly damaging Het
Pkn1 A G 8: 83,671,378 V795A probably damaging Het
Pla2g6 A C 15: 79,286,764 L804R probably damaging Het
Poglut1 A T 16: 38,537,905 probably null Het
Prkcz A T 4: 155,289,710 V83D probably damaging Het
Prss50 T C 9: 110,861,260 F157S probably benign Het
Psors1c2 A G 17: 35,534,202 probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rab7 G A 6: 88,004,179 L174F probably damaging Het
Rapgef4 A G 2: 72,242,739 T790A probably benign Het
Rb1cc1 G T 1: 6,245,309 V503L probably damaging Het
Sbf1 T A 15: 89,302,730 E815V probably damaging Het
Setd3 T A 12: 108,160,267 E104V probably damaging Het
Slc39a5 A T 10: 128,398,410 L208Q probably damaging Het
Slc39a5 G T 10: 128,398,411 L208M probably damaging Het
Slc3a1 T G 17: 85,032,845 Y232D probably damaging Het
Slc8a1 T A 17: 81,649,112 S166C probably damaging Het
Stard9 T A 2: 120,702,398 D3045E probably benign Het
Stk4 C A 2: 164,096,831 D206E probably damaging Het
Syn3 T C 10: 86,466,982 D103G probably damaging Het
Tbc1d30 T A 10: 121,279,146 Y369F probably benign Het
Tenm2 G T 11: 36,047,264 Y1527* probably null Het
Tfg T C 16: 56,705,625 K85R possibly damaging Het
Timp3 T C 10: 86,300,885 L11P probably damaging Het
Tmem144 A T 3: 79,827,711 probably null Het
Tmtc4 T C 14: 122,921,265 N682S probably benign Het
Tnks2 C T 19: 36,866,066 L464F probably damaging Het
Trank1 T C 9: 111,392,039 F2615L probably benign Het
Trio T C 15: 27,744,137 K2570E probably damaging Het
Trio T A 15: 27,773,927 D673V probably damaging Het
Ublcp1 A T 11: 44,465,631 C87S probably benign Het
Wdr41 C T 13: 95,018,948 H404Y probably damaging Het
Zfp280b T C 10: 76,038,494 L69S probably damaging Het
Zfp346 T C 13: 55,132,308 S282P probably damaging Het
Zfp579 C A 7: 4,993,521 E464* probably null Het
Zfp78 T A 7: 6,375,514 probably null Het
Zswim9 T C 7: 13,269,366 E186G probably damaging Het
Other mutations in Unc13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Unc13a APN 8 71643147 missense probably null 0.70
IGL01023:Unc13a APN 8 71661825 missense probably benign 0.02
IGL01456:Unc13a APN 8 71644567 missense probably damaging 1.00
IGL01820:Unc13a APN 8 71654947 missense probably damaging 0.99
IGL01909:Unc13a APN 8 71639210 splice site probably benign
IGL01925:Unc13a APN 8 71634543 missense possibly damaging 0.95
IGL02407:Unc13a APN 8 71648942 missense probably damaging 0.99
IGL02622:Unc13a APN 8 71652514 splice site probably null
IGL02634:Unc13a APN 8 71655701 missense probably benign 0.03
IGL02724:Unc13a APN 8 71656305 splice site probably benign
IGL02892:Unc13a APN 8 71649910 missense probably damaging 1.00
IGL02948:Unc13a APN 8 71650549 missense possibly damaging 0.63
IGL03081:Unc13a APN 8 71649549 missense probably damaging 0.98
IGL03372:Unc13a APN 8 71655709 missense probably damaging 1.00
curvy UTSW 8 71630504 splice site probably null
Greed UTSW 8 71654845 missense probably damaging 1.00
largesse UTSW 8 71634658 missense probably damaging 1.00
serpiginous UTSW 8 71664245 missense probably damaging 1.00
PIT4469001:Unc13a UTSW 8 71658314 nonsense probably null
R0067:Unc13a UTSW 8 71634658 missense probably damaging 1.00
R0067:Unc13a UTSW 8 71634658 missense probably damaging 1.00
R0389:Unc13a UTSW 8 71658032 missense probably benign 0.01
R0457:Unc13a UTSW 8 71658001 critical splice donor site probably null
R0478:Unc13a UTSW 8 71651148 missense possibly damaging 0.92
R0483:Unc13a UTSW 8 71644913 missense probably damaging 0.96
R0609:Unc13a UTSW 8 71658467 missense probably damaging 0.96
R0611:Unc13a UTSW 8 71649865 missense probably damaging 1.00
R0730:Unc13a UTSW 8 71656285 missense possibly damaging 0.68
R0883:Unc13a UTSW 8 71642173 nonsense probably null
R1162:Unc13a UTSW 8 71647917 missense probably benign 0.31
R1185:Unc13a UTSW 8 71661833 missense probably benign 0.13
R1185:Unc13a UTSW 8 71661833 missense probably benign 0.13
R1185:Unc13a UTSW 8 71661833 missense probably benign 0.13
R1196:Unc13a UTSW 8 71654986 missense probably damaging 1.00
R1400:Unc13a UTSW 8 71651221 missense probably damaging 1.00
R1446:Unc13a UTSW 8 71648981 missense possibly damaging 0.91
R1507:Unc13a UTSW 8 71658266 missense probably benign
R1636:Unc13a UTSW 8 71653390 missense probably damaging 1.00
R1858:Unc13a UTSW 8 71652399 missense probably damaging 1.00
R2107:Unc13a UTSW 8 71656251 splice site probably null
R2286:Unc13a UTSW 8 71630559 missense probably damaging 1.00
R2334:Unc13a UTSW 8 71634558 missense probably damaging 1.00
R2924:Unc13a UTSW 8 71644952 missense possibly damaging 0.88
R3177:Unc13a UTSW 8 71629695 missense probably benign 0.01
R3277:Unc13a UTSW 8 71629695 missense probably benign 0.01
R4175:Unc13a UTSW 8 71667724 intron probably benign
R4279:Unc13a UTSW 8 71666667 missense probably damaging 0.98
R4629:Unc13a UTSW 8 71653453 missense possibly damaging 0.65
R4803:Unc13a UTSW 8 71662850 splice site probably null
R4877:Unc13a UTSW 8 71658616 missense possibly damaging 0.85
R4927:Unc13a UTSW 8 71654845 missense probably damaging 1.00
R4930:Unc13a UTSW 8 71630504 splice site probably null
R4994:Unc13a UTSW 8 71643172 missense probably benign 0.28
R5011:Unc13a UTSW 8 71641477 nonsense probably null
R5252:Unc13a UTSW 8 71652564 missense probably damaging 1.00
R5356:Unc13a UTSW 8 71662514 missense probably benign 0.02
R5458:Unc13a UTSW 8 71664245 missense probably damaging 1.00
R5514:Unc13a UTSW 8 71643151 missense probably damaging 1.00
R5784:Unc13a UTSW 8 71655666 missense possibly damaging 0.61
R5853:Unc13a UTSW 8 71655129 splice site probably null
R6183:Unc13a UTSW 8 71644666 missense probably damaging 1.00
R6277:Unc13a UTSW 8 71666639 critical splice donor site probably null
R6374:Unc13a UTSW 8 71641453 missense possibly damaging 0.70
R6392:Unc13a UTSW 8 71637809 missense possibly damaging 0.83
R6515:Unc13a UTSW 8 71647940 missense probably benign 0.44
R6576:Unc13a UTSW 8 71653478 missense probably benign 0.00
R6943:Unc13a UTSW 8 71652377 missense probably damaging 1.00
R7045:Unc13a UTSW 8 71658763 missense possibly damaging 0.95
R7062:Unc13a UTSW 8 71663237 missense probably benign 0.00
R7146:Unc13a UTSW 8 71630553 missense probably damaging 1.00
R7260:Unc13a UTSW 8 71660585 missense possibly damaging 0.71
R7443:Unc13a UTSW 8 71630959 missense probably damaging 0.98
R7545:Unc13a UTSW 8 71641509 critical splice acceptor site probably null
R7644:Unc13a UTSW 8 71634538 missense probably benign 0.13
R7780:Unc13a UTSW 8 71658335 missense probably benign 0.02
Z1088:Unc13a UTSW 8 71654803 critical splice donor site probably null
Z1177:Unc13a UTSW 8 71644872 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTTCACCCTTGATTACACCTGAG -3'
(R):5'- ACCTTCACCATGTTACCCAGG -3'

Sequencing Primer
(F):5'- GTGACCCCCTAAACCCCAGTG -3'
(R):5'- ACCCAGGTGTTTTCCCCAGAG -3'
Posted On2014-08-25