Incidental Mutation 'R1985:Kcna6'
ID220455
Institutional Source Beutler Lab
Gene Symbol Kcna6
Ensembl Gene ENSMUSG00000038077
Gene Namepotassium voltage-gated channel, shaker-related, subfamily, member 6
SynonymsMK1.6, Kv1.6
MMRRC Submission 039997-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1985 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location126708329-126740674 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126738510 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 472 (E472G)
Ref Sequence ENSEMBL: ENSMUSP00000139481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040751] [ENSMUST00000112242] [ENSMUST00000185333]
Predicted Effect probably benign
Transcript: ENSMUST00000040751
AA Change: E472G

PolyPhen 2 Score 0.339 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000036872
Gene: ENSMUSG00000038077
AA Change: E472G

DomainStartEndE-ValueType
BTB 41 141 3.64e-9 SMART
transmembrane domain 175 197 N/A INTRINSIC
low complexity region 223 230 N/A INTRINSIC
low complexity region 240 257 N/A INTRINSIC
Pfam:Ion_trans 265 457 3.6e-36 PFAM
Pfam:Ion_trans_2 377 462 8.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112242
AA Change: E472G

PolyPhen 2 Score 0.339 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107861
Gene: ENSMUSG00000038077
AA Change: E472G

DomainStartEndE-ValueType
BTB 41 141 3.64e-9 SMART
Pfam:Ion_trans 173 469 6.1e-52 PFAM
Pfam:Ion_trans_2 377 462 3.8e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128137
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181126
Predicted Effect probably benign
Transcript: ENSMUST00000185333
AA Change: E472G

PolyPhen 2 Score 0.339 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000139481
Gene: ENSMUSG00000038077
AA Change: E472G

DomainStartEndE-ValueType
BTB 41 141 3.64e-9 SMART
transmembrane domain 175 197 N/A INTRINSIC
low complexity region 223 230 N/A INTRINSIC
low complexity region 240 257 N/A INTRINSIC
Pfam:Ion_trans 265 457 3.6e-36 PFAM
Pfam:Ion_trans_2 377 462 8.1e-14 PFAM
Meta Mutation Damage Score 0.1946 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 94% (76/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the delayed rectifier class. The coding region of this gene is intronless, and the gene is clustered with genes KCNA1 and KCNA5 on chromosome 12. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in an increased thermal nociceptive threshold and in females an increase in circulating triglyceride levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190007I07Rik T A 10: 82,620,217 T37S possibly damaging Het
AA792892 A T 5: 94,384,072 I272L probably benign Het
Abhd8 C A 8: 71,463,513 probably benign Het
Adam5 A T 8: 24,746,739 D648E probably benign Het
Akr1d1 A G 6: 37,558,401 D240G probably damaging Het
Ankmy2 A G 12: 36,157,364 H3R possibly damaging Het
Anpep A C 7: 79,840,857 probably null Het
Apobr A G 7: 126,587,731 T20A possibly damaging Het
Atp2a2 A T 5: 122,466,836 Y427N probably benign Het
Camkk2 A C 5: 122,764,127 S40A possibly damaging Het
Camp T C 9: 109,848,429 N112S probably benign Het
Cbx7 A G 15: 79,918,390 S229P probably damaging Het
Cnot2 T C 10: 116,527,876 N41S probably damaging Het
Dchs1 A G 7: 105,772,398 F272L possibly damaging Het
Dct T C 14: 118,036,542 K318E probably benign Het
Dhrs11 A C 11: 84,828,807 L31V probably damaging Het
Dnah7a T C 1: 53,503,934 D2359G probably benign Het
Dnajc7 A G 11: 100,590,892 S305P probably benign Het
Dscc1 CTGAATGAAT CTGAAT 15: 55,080,176 probably benign Het
Fam71b T C 11: 46,407,866 *666Q probably null Het
Flnc A G 6: 29,444,416 probably benign Het
Gm7535 A G 17: 17,911,538 probably benign Het
Grtp1 A G 8: 13,179,376 F313L probably damaging Het
Haus6 T C 4: 86,593,609 Y425C possibly damaging Het
Hdac1 T A 4: 129,528,960 N83Y possibly damaging Het
Hdlbp A G 1: 93,431,118 I237T probably damaging Het
Hfm1 A T 5: 106,898,576 D481E probably damaging Het
Hipk3 T C 2: 104,434,435 I737V probably benign Het
Il23r T A 6: 67,490,668 probably null Het
Il24 G A 1: 130,882,531 T196I probably benign Het
Ints3 C T 3: 90,400,303 probably null Het
Kcnj16 C T 11: 111,025,583 T357M probably benign Het
Kdm4b T A 17: 56,401,302 V957E probably damaging Het
Kif21b G A 1: 136,147,546 D166N probably damaging Het
Klhl11 G T 11: 100,463,244 Q584K probably benign Het
Krt9 A T 11: 100,189,991 M345K probably benign Het
Lgr5 T C 10: 115,495,245 probably benign Het
Lilr4b A T 10: 51,481,735 Q80L possibly damaging Het
Lrrc69 T C 4: 14,708,669 E225G possibly damaging Het
Ly9 A G 1: 171,599,773 S405P probably damaging Het
Myh2 A G 11: 67,180,914 D519G possibly damaging Het
Nav3 G A 10: 109,770,184 probably benign Het
Nfkb1 G A 3: 135,615,349 T215I possibly damaging Het
Ninj2 A T 6: 120,198,639 probably benign Het
Obsl1 A G 1: 75,505,600 C209R probably damaging Het
Olfr1393 T C 11: 49,280,283 I45T probably damaging Het
Olfr314 A C 11: 58,786,384 D50A probably damaging Het
Olfr531 A T 7: 140,400,800 M82K possibly damaging Het
Olfr539 G A 7: 140,667,821 C171Y probably damaging Het
Olfr619 A T 7: 103,603,672 Y6F probably benign Het
Olfr710 A G 7: 106,944,926 I25T probably benign Het
Otud4 G C 8: 79,640,012 R36P probably damaging Het
Pcnt C T 10: 76,380,337 R2239H possibly damaging Het
Pgbd5 T A 8: 124,370,592 M491L probably benign Het
Pitrm1 A T 13: 6,558,184 D316V probably damaging Het
Plod3 A G 5: 136,990,853 probably null Het
Plppr3 A T 10: 79,867,460 Y63* probably null Het
Prickle2 T C 6: 92,411,452 D323G probably damaging Het
Psmd11 A T 11: 80,445,263 I114F probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rbp3 T G 14: 33,956,461 S789A probably benign Het
Rfxap C A 3: 54,807,326 R117L probably damaging Het
Rims2 T A 15: 39,345,314 M171K probably damaging Het
Scin A G 12: 40,133,908 probably null Het
Scn11a A G 9: 119,754,678 S1624P probably benign Het
Slc41a3 G A 6: 90,642,228 V330M probably damaging Het
Slc9c1 A G 16: 45,550,106 I237V probably benign Het
Spag6 A G 2: 18,732,119 I218V probably benign Het
Stam2 T C 2: 52,709,626 T257A possibly damaging Het
Tbc1d24 G A 17: 24,207,964 R318* probably null Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Trpm3 T A 19: 22,926,082 Y1069N possibly damaging Het
Tuba8 A G 6: 121,220,520 D47G probably benign Het
Tulp3 A T 6: 128,326,806 S277T probably benign Het
Wdr7 GTT GT 18: 63,760,583 probably null Het
Ybx2 A G 11: 69,936,468 probably null Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp788 T A 7: 41,650,481 I795N probably damaging Het
Other mutations in Kcna6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Kcna6 APN 6 126738613 missense probably damaging 1.00
IGL01623:Kcna6 APN 6 126738613 missense probably damaging 1.00
IGL02385:Kcna6 APN 6 126738954 missense probably benign
IGL02452:Kcna6 APN 6 126738480 missense possibly damaging 0.57
IGL02480:Kcna6 APN 6 126738568 missense probably damaging 1.00
IGL02604:Kcna6 APN 6 126739204 missense probably benign 0.17
IGL02794:Kcna6 APN 6 126738552 missense probably damaging 1.00
R1599:Kcna6 UTSW 6 126739319 missense probably benign 0.00
R1932:Kcna6 UTSW 6 126738488 missense probably benign 0.16
R1984:Kcna6 UTSW 6 126738510 missense probably benign 0.34
R2114:Kcna6 UTSW 6 126739359 missense possibly damaging 0.93
R4111:Kcna6 UTSW 6 126739774 missense probably damaging 1.00
R4112:Kcna6 UTSW 6 126739774 missense probably damaging 1.00
R4793:Kcna6 UTSW 6 126738556 missense probably damaging 1.00
R4818:Kcna6 UTSW 6 126738424 missense probably benign 0.00
R4884:Kcna6 UTSW 6 126738726 missense probably benign 0.08
R5126:Kcna6 UTSW 6 126738732 missense probably damaging 1.00
R5754:Kcna6 UTSW 6 126739725 missense probably damaging 1.00
R6074:Kcna6 UTSW 6 126739279 missense probably benign
R7332:Kcna6 UTSW 6 126739329 missense possibly damaging 0.89
R7766:Kcna6 UTSW 6 126739719 missense probably damaging 1.00
R7846:Kcna6 UTSW 6 126739020 missense probably damaging 1.00
R7897:Kcna6 UTSW 6 126738798 missense probably damaging 1.00
R7929:Kcna6 UTSW 6 126739020 missense probably damaging 1.00
R7980:Kcna6 UTSW 6 126738798 missense probably damaging 1.00
R8000:Kcna6 UTSW 6 126738985 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCCATCAAACCTCGGTGAG -3'
(R):5'- GCTGATGATGTTGACTCGCTC -3'

Sequencing Primer
(F):5'- TCAAACCTCGGTGAGCATCC -3'
(R):5'- CAGATGCCTTCTGGTGGGC -3'
Posted On2014-08-25