Incidental Mutation 'R1985:Apobr'
ID220468
Institutional Source Beutler Lab
Gene Symbol Apobr
Ensembl Gene ENSMUSG00000042759
Gene Nameapolipoprotein B receptor
SynonymsApob-48r, Apob48r
MMRRC Submission 039997-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R1985 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location126584942-126589112 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126587731 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 20 (T20A)
Ref Sequence ENSEMBL: ENSMUSP00000145535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032962] [ENSMUST00000039522] [ENSMUST00000058429] [ENSMUST00000084589] [ENSMUST00000098036] [ENSMUST00000116269] [ENSMUST00000125508] [ENSMUST00000128970] [ENSMUST00000131860] [ENSMUST00000137646] [ENSMUST00000138558] [ENSMUST00000144173] [ENSMUST00000147086] [ENSMUST00000150311] [ENSMUST00000150587] [ENSMUST00000150917]
Predicted Effect probably benign
Transcript: ENSMUST00000032962
SMART Domains Protein: ENSMUSP00000032962
Gene: ENSMUSG00000030720

DomainStartEndE-ValueType
Pfam:CLN3 37 438 3.5e-215 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000039522
AA Change: T805A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000042028
Gene: ENSMUSG00000042759
AA Change: T805A

DomainStartEndE-ValueType
low complexity region 45 59 N/A INTRINSIC
low complexity region 171 181 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
low complexity region 381 396 N/A INTRINSIC
low complexity region 465 476 N/A INTRINSIC
low complexity region 588 608 N/A INTRINSIC
low complexity region 837 862 N/A INTRINSIC
low complexity region 869 881 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058429
SMART Domains Protein: ENSMUSP00000054637
Gene: ENSMUSG00000044701

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 137 148 N/A INTRINSIC
low complexity region 160 177 N/A INTRINSIC
low complexity region 210 228 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084589
SMART Domains Protein: ENSMUSP00000081636
Gene: ENSMUSG00000030720

DomainStartEndE-ValueType
Pfam:CLN3 37 438 3.5e-215 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098036
SMART Domains Protein: ENSMUSP00000095644
Gene: ENSMUSG00000030720

DomainStartEndE-ValueType
Pfam:CLN3 37 414 4.3e-191 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116269
SMART Domains Protein: ENSMUSP00000111973
Gene: ENSMUSG00000030720

DomainStartEndE-ValueType
Pfam:CLN3 39 437 1.6e-140 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125508
SMART Domains Protein: ENSMUSP00000117561
Gene: ENSMUSG00000030720

DomainStartEndE-ValueType
Pfam:CLN3 37 76 1.2e-17 PFAM
Pfam:CLN3 73 151 2.8e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128049
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128225
Predicted Effect probably benign
Transcript: ENSMUST00000128970
SMART Domains Protein: ENSMUSP00000114901
Gene: ENSMUSG00000030720

DomainStartEndE-ValueType
Pfam:CLN3 37 196 1.2e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131860
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134406
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134498
Predicted Effect probably benign
Transcript: ENSMUST00000137646
Predicted Effect probably benign
Transcript: ENSMUST00000138558
Predicted Effect possibly damaging
Transcript: ENSMUST00000144173
AA Change: T20A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000147086
Predicted Effect probably benign
Transcript: ENSMUST00000150311
SMART Domains Protein: ENSMUSP00000116160
Gene: ENSMUSG00000030720

DomainStartEndE-ValueType
Pfam:CLN3 37 69 1.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150587
SMART Domains Protein: ENSMUSP00000118054
Gene: ENSMUSG00000030720

DomainStartEndE-ValueType
Pfam:CLN3 37 70 4.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150917
SMART Domains Protein: ENSMUSP00000138688
Gene: ENSMUSG00000030720

DomainStartEndE-ValueType
Pfam:CLN3 37 77 1.6e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153790
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 94% (76/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Apolipoprotein B48 receptor is a macrophage receptor that binds to the apolipoprotein B48 of dietary triglyceride (TG)-rich lipoproteins. This receptor may provide essential lipids, lipid-soluble vitamins and other nutrients to reticuloendothelial cells. If overwhelmed with elevated plasma triglyceride, the apolipoprotein B48 receptor may contribute to foam cell formation, endothelial dysfunction, and atherothrombogenesis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190007I07Rik T A 10: 82,620,217 T37S possibly damaging Het
AA792892 A T 5: 94,384,072 I272L probably benign Het
Abhd8 C A 8: 71,463,513 probably benign Het
Adam5 A T 8: 24,746,739 D648E probably benign Het
Akr1d1 A G 6: 37,558,401 D240G probably damaging Het
Ankmy2 A G 12: 36,157,364 H3R possibly damaging Het
Anpep A C 7: 79,840,857 probably null Het
Atp2a2 A T 5: 122,466,836 Y427N probably benign Het
Camkk2 A C 5: 122,764,127 S40A possibly damaging Het
Camp T C 9: 109,848,429 N112S probably benign Het
Cbx7 A G 15: 79,918,390 S229P probably damaging Het
Cnot2 T C 10: 116,527,876 N41S probably damaging Het
Dchs1 A G 7: 105,772,398 F272L possibly damaging Het
Dct T C 14: 118,036,542 K318E probably benign Het
Dhrs11 A C 11: 84,828,807 L31V probably damaging Het
Dnah7a T C 1: 53,503,934 D2359G probably benign Het
Dnajc7 A G 11: 100,590,892 S305P probably benign Het
Dscc1 CTGAATGAAT CTGAAT 15: 55,080,176 probably benign Het
Fam71b T C 11: 46,407,866 *666Q probably null Het
Flnc A G 6: 29,444,416 probably benign Het
Gm7535 A G 17: 17,911,538 probably benign Het
Grtp1 A G 8: 13,179,376 F313L probably damaging Het
Haus6 T C 4: 86,593,609 Y425C possibly damaging Het
Hdac1 T A 4: 129,528,960 N83Y possibly damaging Het
Hdlbp A G 1: 93,431,118 I237T probably damaging Het
Hfm1 A T 5: 106,898,576 D481E probably damaging Het
Hipk3 T C 2: 104,434,435 I737V probably benign Het
Il23r T A 6: 67,490,668 probably null Het
Il24 G A 1: 130,882,531 T196I probably benign Het
Ints3 C T 3: 90,400,303 probably null Het
Kcna6 T C 6: 126,738,510 E472G probably benign Het
Kcnj16 C T 11: 111,025,583 T357M probably benign Het
Kdm4b T A 17: 56,401,302 V957E probably damaging Het
Kif21b G A 1: 136,147,546 D166N probably damaging Het
Klhl11 G T 11: 100,463,244 Q584K probably benign Het
Krt9 A T 11: 100,189,991 M345K probably benign Het
Lgr5 T C 10: 115,495,245 probably benign Het
Lilr4b A T 10: 51,481,735 Q80L possibly damaging Het
Lrrc69 T C 4: 14,708,669 E225G possibly damaging Het
Ly9 A G 1: 171,599,773 S405P probably damaging Het
Myh2 A G 11: 67,180,914 D519G possibly damaging Het
Nav3 G A 10: 109,770,184 probably benign Het
Nfkb1 G A 3: 135,615,349 T215I possibly damaging Het
Ninj2 A T 6: 120,198,639 probably benign Het
Obsl1 A G 1: 75,505,600 C209R probably damaging Het
Olfr1393 T C 11: 49,280,283 I45T probably damaging Het
Olfr314 A C 11: 58,786,384 D50A probably damaging Het
Olfr531 A T 7: 140,400,800 M82K possibly damaging Het
Olfr539 G A 7: 140,667,821 C171Y probably damaging Het
Olfr619 A T 7: 103,603,672 Y6F probably benign Het
Olfr710 A G 7: 106,944,926 I25T probably benign Het
Otud4 G C 8: 79,640,012 R36P probably damaging Het
Pcnt C T 10: 76,380,337 R2239H possibly damaging Het
Pgbd5 T A 8: 124,370,592 M491L probably benign Het
Pitrm1 A T 13: 6,558,184 D316V probably damaging Het
Plod3 A G 5: 136,990,853 probably null Het
Plppr3 A T 10: 79,867,460 Y63* probably null Het
Prickle2 T C 6: 92,411,452 D323G probably damaging Het
Psmd11 A T 11: 80,445,263 I114F probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rbp3 T G 14: 33,956,461 S789A probably benign Het
Rfxap C A 3: 54,807,326 R117L probably damaging Het
Rims2 T A 15: 39,345,314 M171K probably damaging Het
Scin A G 12: 40,133,908 probably null Het
Scn11a A G 9: 119,754,678 S1624P probably benign Het
Slc41a3 G A 6: 90,642,228 V330M probably damaging Het
Slc9c1 A G 16: 45,550,106 I237V probably benign Het
Spag6 A G 2: 18,732,119 I218V probably benign Het
Stam2 T C 2: 52,709,626 T257A possibly damaging Het
Tbc1d24 G A 17: 24,207,964 R318* probably null Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Trpm3 T A 19: 22,926,082 Y1069N possibly damaging Het
Tuba8 A G 6: 121,220,520 D47G probably benign Het
Tulp3 A T 6: 128,326,806 S277T probably benign Het
Wdr7 GTT GT 18: 63,760,583 probably null Het
Ybx2 A G 11: 69,936,468 probably null Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp788 T A 7: 41,650,481 I795N probably damaging Het
Other mutations in Apobr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01812:Apobr APN 7 126587922 missense probably damaging 1.00
IGL02373:Apobr APN 7 126585391 missense probably damaging 1.00
IGL02383:Apobr APN 7 126586607 missense probably benign 0.35
R0626:Apobr UTSW 7 126586655 missense possibly damaging 0.73
R1142:Apobr UTSW 7 126587482 missense probably benign 0.01
R1672:Apobr UTSW 7 126587551 missense probably benign 0.31
R1711:Apobr UTSW 7 126584979 start gained probably null
R1865:Apobr UTSW 7 126585968 missense probably benign 0.00
R1971:Apobr UTSW 7 126586225 missense probably benign 0.00
R2130:Apobr UTSW 7 126587206 missense probably benign 0.15
R2143:Apobr UTSW 7 126587116 missense probably benign 0.01
R4497:Apobr UTSW 7 126587522 intron probably null
R4693:Apobr UTSW 7 126586847 missense probably damaging 0.96
R4797:Apobr UTSW 7 126587584 missense probably benign 0.30
R4814:Apobr UTSW 7 126586687 missense probably benign 0.03
R5000:Apobr UTSW 7 126586557 missense possibly damaging 0.53
R5153:Apobr UTSW 7 126587732 missense possibly damaging 0.92
R5176:Apobr UTSW 7 126585016 missense probably damaging 1.00
R5285:Apobr UTSW 7 126585003 unclassified probably benign
R5296:Apobr UTSW 7 126588024 missense probably damaging 0.96
R5579:Apobr UTSW 7 126587675 missense probably benign 0.00
Z1088:Apobr UTSW 7 126585031 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGTGACTTTAGGCTCCCAG -3'
(R):5'- ATTCGATGGAAAGAGGGCCTC -3'

Sequencing Primer
(F):5'- TTTAGGCTCCCAGGCAGAGAG -3'
(R):5'- TCCGAGGGACAGAGACATCC -3'
Posted On2014-08-25