Incidental Mutation 'R2025:Tbc1d30'
ID 220474
Institutional Source Beutler Lab
Gene Symbol Tbc1d30
Ensembl Gene ENSMUSG00000052302
Gene Name TBC1 domain family, member 30
Synonyms 4930505D03Rik
MMRRC Submission 040034-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2025 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 121099725-121187183 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 121115051 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 369 (Y369F)
Ref Sequence ENSEMBL: ENSMUSP00000070488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064107]
AlphaFold Q69ZT9
Predicted Effect probably benign
Transcript: ENSMUST00000064107
AA Change: Y369F

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000070488
Gene: ENSMUSG00000052302
AA Change: Y369F

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
TBC 84 318 2.22e-30 SMART
low complexity region 392 403 N/A INTRINSIC
Pfam:DUF4682 475 613 4.3e-50 PFAM
low complexity region 623 633 N/A INTRINSIC
low complexity region 649 657 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218111
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 T C 14: 118,790,737 (GRCm39) M757V probably benign Het
Abitram T A 4: 56,805,916 (GRCm39) I138N probably damaging Het
Acan T G 7: 78,750,970 (GRCm39) S1914A probably benign Het
Axin2 T A 11: 108,833,904 (GRCm39) V617D probably damaging Het
Bhlhe22 A G 3: 18,109,975 (GRCm39) S342G probably benign Het
Cald1 AAGAGAGAGAGAGAG AAGAGAGAGAGAG 6: 34,723,108 (GRCm39) probably null Het
Ccdc34 A G 2: 109,862,731 (GRCm39) K179E possibly damaging Het
Clasp1 A G 1: 118,432,629 (GRCm39) T208A probably damaging Het
Crabp1 C T 9: 54,675,752 (GRCm39) R112* probably null Het
Cstdc1 T C 2: 148,624,148 (GRCm39) F41L probably damaging Het
D130040H23Rik A G 8: 69,755,525 (GRCm39) N310S probably benign Het
Dalrd3 T C 9: 108,448,284 (GRCm39) I278T probably benign Het
Dbp C A 7: 45,357,700 (GRCm39) D89E probably benign Het
Dennd2c A G 3: 103,039,005 (GRCm39) D51G possibly damaging Het
Dido1 A T 2: 180,330,974 (GRCm39) L158* probably null Het
Disp1 G T 1: 182,869,767 (GRCm39) F884L probably damaging Het
Dmrtb1 T C 4: 107,540,782 (GRCm39) D193G probably damaging Het
Dnah8 A G 17: 30,950,133 (GRCm39) D1984G probably damaging Het
Dpf2 T C 19: 5,952,781 (GRCm39) Y218C possibly damaging Het
Dsg4 C T 18: 20,599,693 (GRCm39) Q770* probably null Het
Efemp1 A T 11: 28,864,696 (GRCm39) Y250F possibly damaging Het
Erbin A T 13: 103,966,703 (GRCm39) I1249N probably benign Het
F5 A G 1: 164,037,044 (GRCm39) K1928E probably benign Het
Fhip1b A G 7: 105,038,143 (GRCm39) V260A probably damaging Het
Gdf11 T A 10: 128,727,314 (GRCm39) I81F probably damaging Het
Gm10518 T A 1: 179,631,483 (GRCm39) probably benign Het
Grb10 G C 11: 11,920,576 (GRCm39) S14* probably null Het
Greb1l A T 18: 10,515,221 (GRCm39) Y562F possibly damaging Het
Gtf2ird1 T C 5: 134,392,788 (GRCm39) E789G probably damaging Het
Hook3 T C 8: 26,528,126 (GRCm39) E588G probably damaging Het
Hpx A G 7: 105,244,311 (GRCm39) S266P probably damaging Het
Hs6st3 A G 14: 120,106,801 (GRCm39) D403G probably damaging Het
Igf2bp1 A G 11: 95,864,996 (GRCm39) V151A possibly damaging Het
Itga11 C T 9: 62,670,093 (GRCm39) T739I probably damaging Het
Kalrn T C 16: 34,010,106 (GRCm39) I702V probably damaging Het
Kif2b C T 11: 91,468,172 (GRCm39) S37N probably damaging Het
Kng2 T A 16: 22,819,325 (GRCm39) D237V probably benign Het
Krtap27-1 C A 16: 88,468,173 (GRCm39) V124L possibly damaging Het
Lig4 A T 8: 10,022,436 (GRCm39) L448Q probably damaging Het
Macf1 C T 4: 123,265,711 (GRCm39) A4821T probably damaging Het
Msh5 T A 17: 35,251,768 (GRCm39) I431F possibly damaging Het
Ndufa10 A G 1: 92,367,614 (GRCm39) Y339H probably damaging Het
Nin T A 12: 70,076,782 (GRCm39) Q1091L probably damaging Het
Nom1 A C 5: 29,651,849 (GRCm39) D729A probably damaging Het
Or52e8 C A 7: 104,624,451 (GRCm39) G247V probably benign Het
P2ry14 A T 3: 59,022,866 (GRCm39) V207E probably damaging Het
Pdss2 A T 10: 43,269,871 (GRCm39) N238I possibly damaging Het
Pkn1 A G 8: 84,398,007 (GRCm39) V795A probably damaging Het
Pla2g6 A C 15: 79,170,964 (GRCm39) L804R probably damaging Het
Poglut1 A T 16: 38,358,267 (GRCm39) probably null Het
Prkcz A T 4: 155,374,167 (GRCm39) V83D probably damaging Het
Prss50 T C 9: 110,690,328 (GRCm39) F157S probably benign Het
Psors1c2 A G 17: 35,845,099 (GRCm39) probably benign Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Pwwp4a G T X: 72,171,261 (GRCm39) G218C probably damaging Het
Rab7 G A 6: 87,981,161 (GRCm39) L174F probably damaging Het
Rapgef4 A G 2: 72,073,083 (GRCm39) T790A probably benign Het
Rb1cc1 G T 1: 6,315,533 (GRCm39) V503L probably damaging Het
Sbf1 T A 15: 89,186,933 (GRCm39) E815V probably damaging Het
Setd3 T A 12: 108,126,526 (GRCm39) E104V probably damaging Het
Slc39a5 G T 10: 128,234,280 (GRCm39) L208M probably damaging Het
Slc39a5 A T 10: 128,234,279 (GRCm39) L208Q probably damaging Het
Slc3a1 T G 17: 85,340,273 (GRCm39) Y232D probably damaging Het
Slc8a1 T A 17: 81,956,541 (GRCm39) S166C probably damaging Het
Stard9 T A 2: 120,532,879 (GRCm39) D3045E probably benign Het
Stk4 C A 2: 163,938,751 (GRCm39) D206E probably damaging Het
Syn3 T C 10: 86,302,846 (GRCm39) D103G probably damaging Het
Tenm2 G T 11: 35,938,091 (GRCm39) Y1527* probably null Het
Tfg T C 16: 56,525,988 (GRCm39) K85R possibly damaging Het
Timp3 T C 10: 86,136,749 (GRCm39) L11P probably damaging Het
Tmem144 A T 3: 79,735,018 (GRCm39) probably null Het
Tmtc4 T C 14: 123,158,677 (GRCm39) N682S probably benign Het
Tnks2 C T 19: 36,843,466 (GRCm39) L464F probably damaging Het
Trank1 T C 9: 111,221,107 (GRCm39) F2615L probably benign Het
Trio T C 15: 27,744,223 (GRCm39) K2570E probably damaging Het
Trio T A 15: 27,774,013 (GRCm39) D673V probably damaging Het
Ublcp1 A T 11: 44,356,458 (GRCm39) C87S probably benign Het
Unc13a C T 8: 72,092,412 (GRCm39) E1386K possibly damaging Het
Wdr41 C T 13: 95,155,456 (GRCm39) H404Y probably damaging Het
Zfp280b T C 10: 75,874,328 (GRCm39) L69S probably damaging Het
Zfp346 T C 13: 55,280,121 (GRCm39) S282P probably damaging Het
Zfp579 C A 7: 4,996,520 (GRCm39) E464* probably null Het
Zfp78 T A 7: 6,378,513 (GRCm39) probably null Het
Zswim9 T C 7: 13,003,292 (GRCm39) E186G probably damaging Het
Other mutations in Tbc1d30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00818:Tbc1d30 APN 10 121,102,729 (GRCm39) utr 3 prime probably benign
IGL00837:Tbc1d30 APN 10 121,132,750 (GRCm39) missense probably damaging 1.00
IGL01081:Tbc1d30 APN 10 121,103,319 (GRCm39) missense probably damaging 1.00
IGL01813:Tbc1d30 APN 10 121,102,956 (GRCm39) missense probably benign
IGL01844:Tbc1d30 APN 10 121,103,084 (GRCm39) missense probably benign 0.01
R1782:Tbc1d30 UTSW 10 121,103,525 (GRCm39) missense probably damaging 1.00
R1972:Tbc1d30 UTSW 10 121,142,135 (GRCm39) splice site probably null
R2197:Tbc1d30 UTSW 10 121,140,312 (GRCm39) missense probably damaging 1.00
R3752:Tbc1d30 UTSW 10 121,108,073 (GRCm39) missense probably damaging 1.00
R4374:Tbc1d30 UTSW 10 121,130,617 (GRCm39) missense probably damaging 1.00
R4540:Tbc1d30 UTSW 10 121,115,063 (GRCm39) missense probably damaging 0.99
R4624:Tbc1d30 UTSW 10 121,132,691 (GRCm39) missense probably damaging 0.99
R4960:Tbc1d30 UTSW 10 121,103,121 (GRCm39) missense probably benign 0.04
R5170:Tbc1d30 UTSW 10 121,142,743 (GRCm39) missense possibly damaging 0.49
R5566:Tbc1d30 UTSW 10 121,138,015 (GRCm39) missense probably damaging 1.00
R5642:Tbc1d30 UTSW 10 121,132,692 (GRCm39) missense probably damaging 1.00
R5726:Tbc1d30 UTSW 10 121,103,479 (GRCm39) missense probably damaging 1.00
R6051:Tbc1d30 UTSW 10 121,132,750 (GRCm39) missense probably damaging 1.00
R6364:Tbc1d30 UTSW 10 121,130,630 (GRCm39) missense possibly damaging 0.95
R7106:Tbc1d30 UTSW 10 121,137,897 (GRCm39) missense possibly damaging 0.94
R7233:Tbc1d30 UTSW 10 121,107,962 (GRCm39) missense probably benign 0.35
R7256:Tbc1d30 UTSW 10 121,124,870 (GRCm39) missense probably damaging 1.00
R7826:Tbc1d30 UTSW 10 121,132,710 (GRCm39) missense probably damaging 1.00
R7910:Tbc1d30 UTSW 10 121,183,061 (GRCm39) nonsense probably null
R7958:Tbc1d30 UTSW 10 121,107,962 (GRCm39) missense probably benign 0.35
R7978:Tbc1d30 UTSW 10 121,142,104 (GRCm39) missense probably damaging 1.00
R8021:Tbc1d30 UTSW 10 121,103,448 (GRCm39) missense probably benign 0.09
R8394:Tbc1d30 UTSW 10 121,183,013 (GRCm39) nonsense probably null
R8472:Tbc1d30 UTSW 10 121,187,009 (GRCm39) missense probably benign 0.00
R8532:Tbc1d30 UTSW 10 121,103,335 (GRCm39) missense probably damaging 1.00
R8887:Tbc1d30 UTSW 10 121,187,059 (GRCm39) missense possibly damaging 0.45
R9124:Tbc1d30 UTSW 10 121,132,716 (GRCm39) missense probably damaging 0.99
R9186:Tbc1d30 UTSW 10 121,111,639 (GRCm39) missense probably benign
R9282:Tbc1d30 UTSW 10 121,142,128 (GRCm39) critical splice acceptor site probably null
R9342:Tbc1d30 UTSW 10 121,103,366 (GRCm39) nonsense probably null
R9531:Tbc1d30 UTSW 10 121,183,105 (GRCm39) missense probably damaging 1.00
R9665:Tbc1d30 UTSW 10 121,102,886 (GRCm39) missense possibly damaging 0.83
R9799:Tbc1d30 UTSW 10 121,142,074 (GRCm39) missense possibly damaging 0.55
R9803:Tbc1d30 UTSW 10 121,107,980 (GRCm39) missense probably damaging 1.00
Z1176:Tbc1d30 UTSW 10 121,138,018 (GRCm39) missense probably damaging 1.00
Z1177:Tbc1d30 UTSW 10 121,186,969 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGTTACTTTGCATATATCTGAGGGC -3'
(R):5'- TGCAATATTCCTAGGGCTTTAGTTC -3'

Sequencing Primer
(F):5'- TCTAACCTTCGAGAGACTTGAGGC -3'
(R):5'- GCTAGGATCTCATGTAGCCTAGC -3'
Posted On 2014-08-25