Incidental Mutation 'R2025:Slc39a5'
ID220477
Institutional Source Beutler Lab
Gene Symbol Slc39a5
Ensembl Gene ENSMUSG00000039878
Gene Namesolute carrier family 39 (metal ion transporter), member 5
SynonymsZip5, 2010205A06Rik, 1810013D05Rik
MMRRC Submission 040034-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2025 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location128395931-128401229 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 128398410 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 208 (L208Q)
Ref Sequence ENSEMBL: ENSMUSP00000131736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014642] [ENSMUST00000026439] [ENSMUST00000042666] [ENSMUST00000164199] [ENSMUST00000164664] [ENSMUST00000166608] [ENSMUST00000167859] [ENSMUST00000172348] [ENSMUST00000218858] [ENSMUST00000219131]
Predicted Effect probably benign
Transcript: ENSMUST00000014642
SMART Domains Protein: ENSMUSP00000014642
Gene: ENSMUSG00000014498

DomainStartEndE-ValueType
ANK 7 36 4.44e2 SMART
ANK 40 69 6.55e-5 SMART
ANK 73 102 1.03e-2 SMART
ANK 106 135 1.5e1 SMART
ANK 139 168 5.49e-7 SMART
ANK 172 201 3.01e-4 SMART
ANK 205 234 1.2e-3 SMART
ANK 238 267 2.62e-4 SMART
ANK 271 301 9.78e-4 SMART
ANK 305 334 3.85e-2 SMART
ANK 338 367 5.62e-4 SMART
ANK 371 402 1.55e2 SMART
ANK 422 451 2.16e-5 SMART
ANK 455 484 3.28e-5 SMART
ANK 488 545 2.79e1 SMART
ANK 549 578 5.45e-2 SMART
ANK 584 613 1.84e1 SMART
ANK 617 646 3.85e-2 SMART
ANK 651 682 2.1e-3 SMART
ANK 687 716 6.76e-7 SMART
ANK 720 749 1.07e0 SMART
ANK 753 784 2.92e-2 SMART
ANK 790 819 1.12e-3 SMART
ANK 822 853 9.75e1 SMART
ANK 857 886 1.99e-4 SMART
ANK 890 920 5.09e-2 SMART
ANK 924 953 2.54e-2 SMART
ANK 960 989 1.34e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000026439
SMART Domains Protein: ENSMUSP00000026439
Gene: ENSMUSG00000025374

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 23 105 1.7e-9 PFAM
low complexity region 131 148 N/A INTRINSIC
low complexity region 161 178 N/A INTRINSIC
low complexity region 185 203 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000042666
AA Change: L208Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037753
Gene: ENSMUSG00000039878
AA Change: L208Q

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 50 61 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 133 152 N/A INTRINSIC
Pfam:Zip 208 522 2.3e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164199
SMART Domains Protein: ENSMUSP00000128634
Gene: ENSMUSG00000025374

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 23 105 1.7e-9 PFAM
low complexity region 131 148 N/A INTRINSIC
low complexity region 161 178 N/A INTRINSIC
low complexity region 185 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164664
SMART Domains Protein: ENSMUSP00000127605
Gene: ENSMUSG00000025374

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 22 105 5.8e-10 PFAM
low complexity region 131 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166577
SMART Domains Protein: ENSMUSP00000128794
Gene: ENSMUSG00000014498

DomainStartEndE-ValueType
ANK 18 48 5.09e-2 SMART
ANK 52 81 2.54e-2 SMART
ANK 88 117 1.34e-1 SMART
Blast:ANK 121 148 3e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000166608
SMART Domains Protein: ENSMUSP00000131171
Gene: ENSMUSG00000025374

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 39 120 4.2e-9 PFAM
low complexity region 147 164 N/A INTRINSIC
low complexity region 177 194 N/A INTRINSIC
low complexity region 201 219 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167456
Predicted Effect probably damaging
Transcript: ENSMUST00000167859
AA Change: L208Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131736
Gene: ENSMUSG00000039878
AA Change: L208Q

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 50 61 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 133 152 N/A INTRINSIC
Pfam:Zip 208 522 3.2e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172348
SMART Domains Protein: ENSMUSP00000127015
Gene: ENSMUSG00000025374

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 22 105 6.1e-10 PFAM
low complexity region 131 148 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179358
Predicted Effect probably benign
Transcript: ENSMUST00000218858
Predicted Effect probably benign
Transcript: ENSMUST00000219131
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219222
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ZIP family of zinc transporters that transport zinc into cells from outside, and play a crucial role in controlling intracellular zinc levels. Zinc is an essential cofactor for many enzymes and proteins involved in gene transcription, growth, development and differentiation. Mutations in this gene have been associated with autosomal dominant high myopia (MYP24). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered zinc homeostasis and increased susceptibility to zinc-induced pancretitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik T C 2: 148,782,228 F41L probably damaging Het
Abcc4 T C 14: 118,553,325 M757V probably benign Het
Acan T G 7: 79,101,222 S1914A probably benign Het
Axin2 T A 11: 108,943,078 V617D probably damaging Het
Bhlhe22 A G 3: 18,055,811 S342G probably benign Het
Cald1 AAGAGAGAGAGAGAG AAGAGAGAGAGAG 6: 34,746,173 probably null Het
Ccdc34 A G 2: 110,032,386 K179E possibly damaging Het
Clasp1 A G 1: 118,504,899 T208A probably damaging Het
Crabp1 C T 9: 54,768,468 R112* probably null Het
D130040H23Rik A G 8: 69,302,873 N310S probably benign Het
Dalrd3 T C 9: 108,571,085 I278T probably benign Het
Dbp C A 7: 45,708,276 D89E probably benign Het
Dennd2c A G 3: 103,131,689 D51G possibly damaging Het
Dido1 A T 2: 180,689,181 L158* probably null Het
Disp1 G T 1: 183,088,203 F884L probably damaging Het
Dmrtb1 T C 4: 107,683,585 D193G probably damaging Het
Dnah8 A G 17: 30,731,159 D1984G probably damaging Het
Dpf2 T C 19: 5,902,753 Y218C possibly damaging Het
Dsg4 C T 18: 20,466,636 Q770* probably null Het
Efemp1 A T 11: 28,914,696 Y250F possibly damaging Het
Erbin A T 13: 103,830,195 I1249N probably benign Het
F5 A G 1: 164,209,475 K1928E probably benign Het
Fam160a2 A G 7: 105,388,936 V260A probably damaging Het
Fam206a T A 4: 56,805,916 I138N probably damaging Het
Gdf11 T A 10: 128,891,445 I81F probably damaging Het
Gm10518 T A 1: 179,803,918 probably benign Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Grb10 G C 11: 11,970,576 S14* probably null Het
Greb1l A T 18: 10,515,221 Y562F possibly damaging Het
Gtf2ird1 T C 5: 134,363,934 E789G probably damaging Het
Hook3 T C 8: 26,038,098 E588G probably damaging Het
Hpx A G 7: 105,595,104 S266P probably damaging Het
Hs6st3 A G 14: 119,869,389 D403G probably damaging Het
Igf2bp1 A G 11: 95,974,170 V151A possibly damaging Het
Itga11 C T 9: 62,762,811 T739I probably damaging Het
Kalrn T C 16: 34,189,736 I702V probably damaging Het
Kif2b C T 11: 91,577,346 S37N probably damaging Het
Kng2 T A 16: 23,000,575 D237V probably benign Het
Krtap27-1 C A 16: 88,671,285 V124L possibly damaging Het
Lig4 A T 8: 9,972,436 L448Q probably damaging Het
Macf1 C T 4: 123,371,918 A4821T probably damaging Het
Msh5 T A 17: 35,032,792 I431F possibly damaging Het
Ndufa10 A G 1: 92,439,892 Y339H probably damaging Het
Nin T A 12: 70,030,008 Q1091L probably damaging Het
Nom1 A C 5: 29,446,851 D729A probably damaging Het
Olfr671 C A 7: 104,975,244 G247V probably benign Het
P2ry14 A T 3: 59,115,445 V207E probably damaging Het
Pdss2 A T 10: 43,393,875 N238I possibly damaging Het
Pkn1 A G 8: 83,671,378 V795A probably damaging Het
Pla2g6 A C 15: 79,286,764 L804R probably damaging Het
Poglut1 A T 16: 38,537,905 probably null Het
Prkcz A T 4: 155,289,710 V83D probably damaging Het
Prss50 T C 9: 110,861,260 F157S probably benign Het
Psors1c2 A G 17: 35,534,202 probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rab7 G A 6: 88,004,179 L174F probably damaging Het
Rapgef4 A G 2: 72,242,739 T790A probably benign Het
Rb1cc1 G T 1: 6,245,309 V503L probably damaging Het
Sbf1 T A 15: 89,302,730 E815V probably damaging Het
Setd3 T A 12: 108,160,267 E104V probably damaging Het
Slc3a1 T G 17: 85,032,845 Y232D probably damaging Het
Slc8a1 T A 17: 81,649,112 S166C probably damaging Het
Stard9 T A 2: 120,702,398 D3045E probably benign Het
Stk4 C A 2: 164,096,831 D206E probably damaging Het
Syn3 T C 10: 86,466,982 D103G probably damaging Het
Tbc1d30 T A 10: 121,279,146 Y369F probably benign Het
Tenm2 G T 11: 36,047,264 Y1527* probably null Het
Tfg T C 16: 56,705,625 K85R possibly damaging Het
Timp3 T C 10: 86,300,885 L11P probably damaging Het
Tmem144 A T 3: 79,827,711 probably null Het
Tmtc4 T C 14: 122,921,265 N682S probably benign Het
Tnks2 C T 19: 36,866,066 L464F probably damaging Het
Trank1 T C 9: 111,392,039 F2615L probably benign Het
Trio T C 15: 27,744,137 K2570E probably damaging Het
Trio T A 15: 27,773,927 D673V probably damaging Het
Ublcp1 A T 11: 44,465,631 C87S probably benign Het
Unc13a C T 8: 71,639,768 E1386K possibly damaging Het
Wdr41 C T 13: 95,018,948 H404Y probably damaging Het
Zfp280b T C 10: 76,038,494 L69S probably damaging Het
Zfp346 T C 13: 55,132,308 S282P probably damaging Het
Zfp579 C A 7: 4,993,521 E464* probably null Het
Zfp78 T A 7: 6,375,514 probably null Het
Zswim9 T C 7: 13,269,366 E186G probably damaging Het
Other mutations in Slc39a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02535:Slc39a5 APN 10 128399330 missense probably benign 0.00
IGL02666:Slc39a5 APN 10 128398455 missense probably damaging 1.00
R0305:Slc39a5 UTSW 10 128398396 unclassified probably benign
R0350:Slc39a5 UTSW 10 128396750 critical splice donor site probably null
R0437:Slc39a5 UTSW 10 128399847 missense possibly damaging 0.94
R1401:Slc39a5 UTSW 10 128397741 missense probably damaging 1.00
R2025:Slc39a5 UTSW 10 128398411 missense probably damaging 1.00
R2286:Slc39a5 UTSW 10 128396060 missense probably benign 0.00
R4041:Slc39a5 UTSW 10 128396468 missense possibly damaging 0.95
R4649:Slc39a5 UTSW 10 128397267 missense probably benign 0.00
R4776:Slc39a5 UTSW 10 128397049 missense probably damaging 0.98
R4890:Slc39a5 UTSW 10 128398447 missense probably benign 0.13
R5911:Slc39a5 UTSW 10 128399943 missense probably damaging 1.00
R6703:Slc39a5 UTSW 10 128397782 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATACATGTGGGAGCAGGTG -3'
(R):5'- ATGGCCTTCCCCTCAAAATC -3'

Sequencing Primer
(F):5'- ACTGCCAGGCCACTGTGAAG -3'
(R):5'- AATCTCCAGTGTCTGAATGGC -3'
Posted On2014-08-25