Incidental Mutation 'R1985:Scn11a'
ID220485
Institutional Source Beutler Lab
Gene Symbol Scn11a
Ensembl Gene ENSMUSG00000034115
Gene Namesodium channel, voltage-gated, type XI, alpha
SynonymsNaN, NSS2, NaT, SNS2
MMRRC Submission 039997-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R1985 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location119753759-119825456 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119754678 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1624 (S1624P)
Ref Sequence ENSEMBL: ENSMUSP00000149420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]
Predicted Effect probably benign
Transcript: ENSMUST00000070617
AA Change: S1624P

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115
AA Change: S1624P

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:Ion_trans 128 409 1.1e-72 PFAM
low complexity region 475 487 N/A INTRINSIC
Pfam:Ion_trans 574 810 4e-57 PFAM
Pfam:Na_trans_assoc 814 1030 4.1e-29 PFAM
Pfam:Ion_trans 1034 1300 5.7e-66 PFAM
Pfam:Ion_trans 1346 1595 3e-58 PFAM
low complexity region 1683 1694 N/A INTRINSIC
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215718
AA Change: S1624P

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.0644 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 94% (76/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190007I07Rik T A 10: 82,620,217 T37S possibly damaging Het
AA792892 A T 5: 94,384,072 I272L probably benign Het
Abhd8 C A 8: 71,463,513 probably benign Het
Adam5 A T 8: 24,746,739 D648E probably benign Het
Akr1d1 A G 6: 37,558,401 D240G probably damaging Het
Ankmy2 A G 12: 36,157,364 H3R possibly damaging Het
Anpep A C 7: 79,840,857 probably null Het
Apobr A G 7: 126,587,731 T20A possibly damaging Het
Atp2a2 A T 5: 122,466,836 Y427N probably benign Het
Camkk2 A C 5: 122,764,127 S40A possibly damaging Het
Camp T C 9: 109,848,429 N112S probably benign Het
Cbx7 A G 15: 79,918,390 S229P probably damaging Het
Cnot2 T C 10: 116,527,876 N41S probably damaging Het
Dchs1 A G 7: 105,772,398 F272L possibly damaging Het
Dct T C 14: 118,036,542 K318E probably benign Het
Dhrs11 A C 11: 84,828,807 L31V probably damaging Het
Dnah7a T C 1: 53,503,934 D2359G probably benign Het
Dnajc7 A G 11: 100,590,892 S305P probably benign Het
Dscc1 CTGAATGAAT CTGAAT 15: 55,080,176 probably benign Het
Fam71b T C 11: 46,407,866 *666Q probably null Het
Flnc A G 6: 29,444,416 probably benign Het
Gm7535 A G 17: 17,911,538 probably benign Het
Grtp1 A G 8: 13,179,376 F313L probably damaging Het
Haus6 T C 4: 86,593,609 Y425C possibly damaging Het
Hdac1 T A 4: 129,528,960 N83Y possibly damaging Het
Hdlbp A G 1: 93,431,118 I237T probably damaging Het
Hfm1 A T 5: 106,898,576 D481E probably damaging Het
Hipk3 T C 2: 104,434,435 I737V probably benign Het
Il23r T A 6: 67,490,668 probably null Het
Il24 G A 1: 130,882,531 T196I probably benign Het
Ints3 C T 3: 90,400,303 probably null Het
Kcna6 T C 6: 126,738,510 E472G probably benign Het
Kcnj16 C T 11: 111,025,583 T357M probably benign Het
Kdm4b T A 17: 56,401,302 V957E probably damaging Het
Kif21b G A 1: 136,147,546 D166N probably damaging Het
Klhl11 G T 11: 100,463,244 Q584K probably benign Het
Krt9 A T 11: 100,189,991 M345K probably benign Het
Lgr5 T C 10: 115,495,245 probably benign Het
Lilr4b A T 10: 51,481,735 Q80L possibly damaging Het
Lrrc69 T C 4: 14,708,669 E225G possibly damaging Het
Ly9 A G 1: 171,599,773 S405P probably damaging Het
Myh2 A G 11: 67,180,914 D519G possibly damaging Het
Nav3 G A 10: 109,770,184 probably benign Het
Nfkb1 G A 3: 135,615,349 T215I possibly damaging Het
Ninj2 A T 6: 120,198,639 probably benign Het
Obsl1 A G 1: 75,505,600 C209R probably damaging Het
Olfr1393 T C 11: 49,280,283 I45T probably damaging Het
Olfr314 A C 11: 58,786,384 D50A probably damaging Het
Olfr531 A T 7: 140,400,800 M82K possibly damaging Het
Olfr539 G A 7: 140,667,821 C171Y probably damaging Het
Olfr619 A T 7: 103,603,672 Y6F probably benign Het
Olfr710 A G 7: 106,944,926 I25T probably benign Het
Otud4 G C 8: 79,640,012 R36P probably damaging Het
Pcnt C T 10: 76,380,337 R2239H possibly damaging Het
Pgbd5 T A 8: 124,370,592 M491L probably benign Het
Pitrm1 A T 13: 6,558,184 D316V probably damaging Het
Plod3 A G 5: 136,990,853 probably null Het
Plppr3 A T 10: 79,867,460 Y63* probably null Het
Prickle2 T C 6: 92,411,452 D323G probably damaging Het
Psmd11 A T 11: 80,445,263 I114F probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rbp3 T G 14: 33,956,461 S789A probably benign Het
Rfxap C A 3: 54,807,326 R117L probably damaging Het
Rims2 T A 15: 39,345,314 M171K probably damaging Het
Scin A G 12: 40,133,908 probably null Het
Slc41a3 G A 6: 90,642,228 V330M probably damaging Het
Slc9c1 A G 16: 45,550,106 I237V probably benign Het
Spag6 A G 2: 18,732,119 I218V probably benign Het
Stam2 T C 2: 52,709,626 T257A possibly damaging Het
Tbc1d24 G A 17: 24,207,964 R318* probably null Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Trpm3 T A 19: 22,926,082 Y1069N possibly damaging Het
Tuba8 A G 6: 121,220,520 D47G probably benign Het
Tulp3 A T 6: 128,326,806 S277T probably benign Het
Wdr7 GTT GT 18: 63,760,583 probably null Het
Ybx2 A G 11: 69,936,468 probably null Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp788 T A 7: 41,650,481 I795N probably damaging Het
Other mutations in Scn11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Scn11a APN 9 119770506 missense probably benign 0.00
IGL00272:Scn11a APN 9 119816603 missense probably damaging 0.98
IGL00332:Scn11a APN 9 119769916 missense probably damaging 1.00
IGL00533:Scn11a APN 9 119774381 missense probably damaging 1.00
IGL00972:Scn11a APN 9 119793938 missense probably benign 0.44
IGL01338:Scn11a APN 9 119784161 splice site probably benign
IGL01534:Scn11a APN 9 119780822 missense probably benign 0.27
IGL01838:Scn11a APN 9 119758583 missense probably damaging 1.00
IGL01991:Scn11a APN 9 119819904 missense probably damaging 0.97
IGL02057:Scn11a APN 9 119765470 missense probably damaging 1.00
IGL02290:Scn11a APN 9 119774442 missense probably damaging 0.97
IGL02454:Scn11a APN 9 119758544 missense probably benign 0.00
IGL02517:Scn11a APN 9 119792398 missense probably damaging 1.00
IGL02567:Scn11a APN 9 119804489 missense probably damaging 0.99
IGL02587:Scn11a APN 9 119805684 missense probably damaging 1.00
IGL03069:Scn11a APN 9 119789963 missense probably benign 0.16
IGL03171:Scn11a APN 9 119819847 missense probably benign 0.00
Kleinie UTSW 9 119803503 missense probably benign 0.16
H8441:Scn11a UTSW 9 119807910 missense probably damaging 1.00
PIT4449001:Scn11a UTSW 9 119769948 missense probably damaging 1.00
R0304:Scn11a UTSW 9 119819862 missense probably benign 0.00
R0519:Scn11a UTSW 9 119790119 missense probably damaging 1.00
R0658:Scn11a UTSW 9 119811160 missense probably benign 0.41
R0828:Scn11a UTSW 9 119755007 missense probably benign 0.00
R0893:Scn11a UTSW 9 119803330 splice site probably null
R0932:Scn11a UTSW 9 119807810 missense probably damaging 1.00
R1061:Scn11a UTSW 9 119795663 missense probably damaging 0.98
R1161:Scn11a UTSW 9 119755057 nonsense probably null
R1162:Scn11a UTSW 9 119805644 splice site probably benign
R1310:Scn11a UTSW 9 119755057 nonsense probably null
R1589:Scn11a UTSW 9 119769807 missense probably damaging 1.00
R1681:Scn11a UTSW 9 119804412 missense possibly damaging 0.46
R1781:Scn11a UTSW 9 119755082 missense probably damaging 1.00
R1812:Scn11a UTSW 9 119780865 nonsense probably null
R1901:Scn11a UTSW 9 119779036 nonsense probably null
R1978:Scn11a UTSW 9 119780795 nonsense probably null
R2022:Scn11a UTSW 9 119811208 missense possibly damaging 0.88
R2072:Scn11a UTSW 9 119811208 missense possibly damaging 0.88
R2098:Scn11a UTSW 9 119792494 missense possibly damaging 0.67
R2163:Scn11a UTSW 9 119755025 missense probably damaging 1.00
R2250:Scn11a UTSW 9 119758602 missense probably benign 0.01
R2373:Scn11a UTSW 9 119813186 missense probably benign 0.43
R2508:Scn11a UTSW 9 119765529 missense probably damaging 1.00
R3757:Scn11a UTSW 9 119803503 missense probably benign 0.16
R3767:Scn11a UTSW 9 119784049 missense probably damaging 1.00
R3770:Scn11a UTSW 9 119784049 missense probably damaging 1.00
R4089:Scn11a UTSW 9 119795653 splice site probably null
R4092:Scn11a UTSW 9 119789970 missense probably benign 0.03
R4247:Scn11a UTSW 9 119807886 missense probably damaging 1.00
R4279:Scn11a UTSW 9 119754362 missense probably benign 0.25
R4299:Scn11a UTSW 9 119765506 missense probably damaging 0.97
R4403:Scn11a UTSW 9 119795667 missense probably damaging 1.00
R4468:Scn11a UTSW 9 119754987 missense probably damaging 1.00
R4542:Scn11a UTSW 9 119755134 missense probably damaging 1.00
R4644:Scn11a UTSW 9 119815203 splice site probably null
R4739:Scn11a UTSW 9 119754561 missense probably benign 0.39
R4809:Scn11a UTSW 9 119819870 missense probably benign 0.00
R4954:Scn11a UTSW 9 119758659 missense possibly damaging 0.84
R5012:Scn11a UTSW 9 119780878 missense probably benign 0.31
R5044:Scn11a UTSW 9 119819831 missense probably damaging 0.98
R5222:Scn11a UTSW 9 119815202 splice site probably null
R5224:Scn11a UTSW 9 119754792 missense probably damaging 1.00
R5400:Scn11a UTSW 9 119769908 missense probably damaging 0.97
R5555:Scn11a UTSW 9 119755238 missense probably damaging 1.00
R5711:Scn11a UTSW 9 119789924 missense probably damaging 1.00
R5950:Scn11a UTSW 9 119811124 missense probably damaging 1.00
R5984:Scn11a UTSW 9 119784016 missense probably benign
R6057:Scn11a UTSW 9 119765448 missense probably damaging 1.00
R6104:Scn11a UTSW 9 119795678 missense probably damaging 1.00
R6180:Scn11a UTSW 9 119754867 missense probably benign 0.00
R6892:Scn11a UTSW 9 119806969 missense possibly damaging 0.53
R6908:Scn11a UTSW 9 119792426 missense probably damaging 1.00
R6949:Scn11a UTSW 9 119765514 missense probably benign 0.04
R7112:Scn11a UTSW 9 119754809 missense probably damaging 1.00
R7232:Scn11a UTSW 9 119759916 missense probably damaging 1.00
R7261:Scn11a UTSW 9 119819833 missense probably damaging 0.99
R7265:Scn11a UTSW 9 119815265 missense probably damaging 1.00
R7302:Scn11a UTSW 9 119806951 missense probably benign 0.03
R7391:Scn11a UTSW 9 119795717 missense probably damaging 1.00
R7441:Scn11a UTSW 9 119758626 missense probably benign 0.01
R7479:Scn11a UTSW 9 119759875 missense probably benign 0.38
R7608:Scn11a UTSW 9 119815313 splice site probably null
R7768:Scn11a UTSW 9 119815272 missense probably benign 0.13
R7785:Scn11a UTSW 9 119816556 missense probably benign 0.00
R7794:Scn11a UTSW 9 119765514 missense probably damaging 0.99
R7818:Scn11a UTSW 9 119784111 missense probably damaging 0.97
R7884:Scn11a UTSW 9 119804551 missense probably benign 0.01
R7988:Scn11a UTSW 9 119765437 missense probably damaging 0.97
R8049:Scn11a UTSW 9 119755083 missense probably damaging 1.00
R8127:Scn11a UTSW 9 119804512 missense probably damaging 1.00
R8274:Scn11a UTSW 9 119803482 missense probably benign
R8344:Scn11a UTSW 9 119781970 missense probably benign 0.00
R8346:Scn11a UTSW 9 119778981 missense probably damaging 1.00
Z1088:Scn11a UTSW 9 119755242 missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119754998 missense possibly damaging 0.94
Z1177:Scn11a UTSW 9 119819820 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATGGTATCCAAGCCGCTG -3'
(R):5'- ATTCCTCCTCCCAAGAGAGCTG -3'

Sequencing Primer
(F):5'- TATCCAAGCCGCTGGAGTTC -3'
(R):5'- GCAGATAGCCATAGTCTACTTCG -3'
Posted On2014-08-25