Mutagenetix > Incidental Mutation

Incidental Mutation 'R2025:Tenm2'

220486

Institutional Source

Beutler Lab

Gene Symbol

Tenm2

Ensembl Gene

ENSMUSG00000049336

Gene Name

teneurin transmembrane protein 2

Synonyms

2610040L17Rik, 9330187F13Rik, D3Bwg1534e, Ten-m2, Odz2

MMRRC Submission

040034-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.471) question?

Stock #

R2025 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

36006656-37235964 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 36047264 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 1527 (Y1527*)

Ref Sequence

ENSEMBL: ENSMUSP00000129951 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057207] [ENSMUST00000102801] [ENSMUST00000163524]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000057207
AA Change: Y1528*

SMART Domains

Protein: ENSMUSP00000052014
Gene: ENSMUSG00000049336
AA Change: Y1528*

Domain	Start	End	E-Value	Type
Pfam:Ten_N	10	374	4.9e-177	PFAM
transmembrane domain	375	397	N/A	INTRINSIC
EGF	575	603	5.62e0	SMART
EGF_like	606	634	4.93e1	SMART
EGF	639	668	1.76e1	SMART
EGF	671	700	1.43e-1	SMART
EGF	705	735	1.2e1	SMART
EGF	738	766	9.63e0	SMART
EGF	769	797	1.25e1	SMART
EGF	800	832	1.4e0	SMART
low complexity region	1459	1475	N/A	INTRINSIC
low complexity region	2219	2230	N/A	INTRINSIC
Pfam:Tox-GHH	2681	2758	1.4e-34	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000102801
AA Change: Y1527*

SMART Domains

Protein: ENSMUSP00000099865
Gene: ENSMUSG00000049336
AA Change: Y1527*

Domain	Start	End	E-Value	Type
Pfam:Ten_N	9	374	2e-186	PFAM
transmembrane domain	375	397	N/A	INTRINSIC
EGF	575	603	5.62e0	SMART
EGF_like	606	634	4.93e1	SMART
EGF	639	668	1.76e1	SMART
EGF	671	700	1.43e-1	SMART
EGF	705	735	1.2e1	SMART
EGF	737	765	9.63e0	SMART
EGF	768	796	1.25e1	SMART
EGF	799	831	1.4e0	SMART
low complexity region	1458	1474	N/A	INTRINSIC
low complexity region	2218	2229	N/A	INTRINSIC
Pfam:Tox-GHH	2679	2757	2e-34	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000163524
AA Change: Y1527*

SMART Domains

Protein: ENSMUSP00000129951
Gene: ENSMUSG00000049336
AA Change: Y1527*

Domain	Start	End	E-Value	Type
Pfam:Ten_N	9	374	2e-186	PFAM
transmembrane domain	375	397	N/A	INTRINSIC
EGF	575	603	5.62e0	SMART
EGF_like	606	634	4.93e1	SMART
EGF	639	668	1.76e1	SMART
EGF	671	700	1.43e-1	SMART
EGF	705	735	1.2e1	SMART
EGF	737	765	9.63e0	SMART
EGF	768	796	1.25e1	SMART
EGF	799	831	1.4e0	SMART
low complexity region	1458	1474	N/A	INTRINSIC
low complexity region	2218	2229	N/A	INTRINSIC
Pfam:Tox-GHH	2679	2757	2e-34	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 94.6%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele show abnormalities in the laterality and mapping of ipsilateral retinal projections that lead to loss of ipsilateral drive, defects in binocular vision, and impaired performance on a visual discrimination task. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8030411F24Rik	T	C	2: 148,782,228	F41L	probably damaging	Het
Abcc4	T	C	14: 118,553,325	M757V	probably benign	Het
Acan	T	G	7: 79,101,222	S1914A	probably benign	Het
Axin2	T	A	11: 108,943,078	V617D	probably damaging	Het
Bhlhe22	A	G	3: 18,055,811	S342G	probably benign	Het
Cald1	AAGAGAGAGAGAGAG	AAGAGAGAGAGAG	6: 34,746,173		probably null	Het
Ccdc34	A	G	2: 110,032,386	K179E	possibly damaging	Het
Clasp1	A	G	1: 118,504,899	T208A	probably damaging	Het
Crabp1	C	T	9: 54,768,468	R112*	probably null	Het
D130040H23Rik	A	G	8: 69,302,873	N310S	probably benign	Het
Dalrd3	T	C	9: 108,571,085	I278T	probably benign	Het
Dbp	C	A	7: 45,708,276	D89E	probably benign	Het
Dennd2c	A	G	3: 103,131,689	D51G	possibly damaging	Het
Dido1	A	T	2: 180,689,181	L158*	probably null	Het
Disp1	G	T	1: 183,088,203	F884L	probably damaging	Het
Dmrtb1	T	C	4: 107,683,585	D193G	probably damaging	Het
Dnah8	A	G	17: 30,731,159	D1984G	probably damaging	Het
Dpf2	T	C	19: 5,902,753	Y218C	possibly damaging	Het
Dsg4	C	T	18: 20,466,636	Q770*	probably null	Het
Efemp1	A	T	11: 28,914,696	Y250F	possibly damaging	Het
Erbin	A	T	13: 103,830,195	I1249N	probably benign	Het
F5	A	G	1: 164,209,475	K1928E	probably benign	Het
Fam160a2	A	G	7: 105,388,936	V260A	probably damaging	Het
Fam206a	T	A	4: 56,805,916	I138N	probably damaging	Het
Gdf11	T	A	10: 128,891,445	I81F	probably damaging	Het
Gm10518	T	A	1: 179,803,918		probably benign	Het
Gm14685	G	T	X: 73,127,655	G218C	probably damaging	Het
Grb10	G	C	11: 11,970,576	S14*	probably null	Het
Greb1l	A	T	18: 10,515,221	Y562F	possibly damaging	Het
Gtf2ird1	T	C	5: 134,363,934	E789G	probably damaging	Het
Hook3	T	C	8: 26,038,098	E588G	probably damaging	Het
Hpx	A	G	7: 105,595,104	S266P	probably damaging	Het
Hs6st3	A	G	14: 119,869,389	D403G	probably damaging	Het
Igf2bp1	A	G	11: 95,974,170	V151A	possibly damaging	Het
Itga11	C	T	9: 62,762,811	T739I	probably damaging	Het
Kalrn	T	C	16: 34,189,736	I702V	probably damaging	Het
Kif2b	C	T	11: 91,577,346	S37N	probably damaging	Het
Kng2	T	A	16: 23,000,575	D237V	probably benign	Het
Krtap27-1	C	A	16: 88,671,285	V124L	possibly damaging	Het
Lig4	A	T	8: 9,972,436	L448Q	probably damaging	Het
Macf1	C	T	4: 123,371,918	A4821T	probably damaging	Het
Msh5	T	A	17: 35,032,792	I431F	possibly damaging	Het
Ndufa10	A	G	1: 92,439,892	Y339H	probably damaging	Het
Nin	T	A	12: 70,030,008	Q1091L	probably damaging	Het
Nom1	A	C	5: 29,446,851	D729A	probably damaging	Het
Olfr671	C	A	7: 104,975,244	G247V	probably benign	Het
P2ry14	A	T	3: 59,115,445	V207E	probably damaging	Het
Pdss2	A	T	10: 43,393,875	N238I	possibly damaging	Het
Pkn1	A	G	8: 83,671,378	V795A	probably damaging	Het
Pla2g6	A	C	15: 79,286,764	L804R	probably damaging	Het
Poglut1	A	T	16: 38,537,905		probably null	Het
Prkcz	A	T	4: 155,289,710	V83D	probably damaging	Het
Prss50	T	C	9: 110,861,260	F157S	probably benign	Het
Psors1c2	A	G	17: 35,534,202		probably benign	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rab7	G	A	6: 88,004,179	L174F	probably damaging	Het
Rapgef4	A	G	2: 72,242,739	T790A	probably benign	Het
Rb1cc1	G	T	1: 6,245,309	V503L	probably damaging	Het
Sbf1	T	A	15: 89,302,730	E815V	probably damaging	Het
Setd3	T	A	12: 108,160,267	E104V	probably damaging	Het
Slc39a5	A	T	10: 128,398,410	L208Q	probably damaging	Het
Slc39a5	G	T	10: 128,398,411	L208M	probably damaging	Het
Slc3a1	T	G	17: 85,032,845	Y232D	probably damaging	Het
Slc8a1	T	A	17: 81,649,112	S166C	probably damaging	Het
Stard9	T	A	2: 120,702,398	D3045E	probably benign	Het
Stk4	C	A	2: 164,096,831	D206E	probably damaging	Het
Syn3	T	C	10: 86,466,982	D103G	probably damaging	Het
Tbc1d30	T	A	10: 121,279,146	Y369F	probably benign	Het
Tfg	T	C	16: 56,705,625	K85R	possibly damaging	Het
Timp3	T	C	10: 86,300,885	L11P	probably damaging	Het
Tmem144	A	T	3: 79,827,711		probably null	Het
Tmtc4	T	C	14: 122,921,265	N682S	probably benign	Het
Tnks2	C	T	19: 36,866,066	L464F	probably damaging	Het
Trank1	T	C	9: 111,392,039	F2615L	probably benign	Het
Trio	T	C	15: 27,744,137	K2570E	probably damaging	Het
Trio	T	A	15: 27,773,927	D673V	probably damaging	Het
Ublcp1	A	T	11: 44,465,631	C87S	probably benign	Het
Unc13a	C	T	8: 71,639,768	E1386K	possibly damaging	Het
Wdr41	C	T	13: 95,018,948	H404Y	probably damaging	Het
Zfp280b	T	C	10: 76,038,494	L69S	probably damaging	Het
Zfp346	T	C	13: 55,132,308	S282P	probably damaging	Het
Zfp579	C	A	7: 4,993,521	E464*	probably null	Het
Zfp78	T	A	7: 6,375,514		probably null	Het
Zswim9	T	C	7: 13,269,366	E186G	probably damaging	Het

Other mutations in Tenm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Tenm2	APN	11	36206899	splice site	probably benign
IGL00834:Tenm2	APN	11	36024258	missense	probably damaging	1.00
IGL00911:Tenm2	APN	11	36008733	nonsense	probably null
IGL00937:Tenm2	APN	11	36024623	missense	probably damaging	1.00
IGL01154:Tenm2	APN	11	36041544	missense	probably damaging	1.00
IGL01313:Tenm2	APN	11	36024248	missense	probably damaging	0.98
IGL01346:Tenm2	APN	11	36027405	nonsense	probably null
IGL01539:Tenm2	APN	11	36106827	missense	possibly damaging	0.89
IGL01629:Tenm2	APN	11	36864884	missense	probably damaging	0.98
IGL01780:Tenm2	APN	11	36046941	missense	probably benign
IGL01821:Tenm2	APN	11	36023883	missense	probably damaging	0.98
IGL01988:Tenm2	APN	11	36027251	missense	probably damaging	1.00
IGL02002:Tenm2	APN	11	36207095	missense	probably benign
IGL02449:Tenm2	APN	11	36023622	missense	probably damaging	0.99
IGL02505:Tenm2	APN	11	36051916	nonsense	probably null
IGL02649:Tenm2	APN	11	36207085	missense	possibly damaging	0.85
IGL02688:Tenm2	APN	11	36068458	missense	probably benign	0.05
IGL02801:Tenm2	APN	11	36047030	nonsense	probably null
IGL02928:Tenm2	APN	11	36027170	missense	possibly damaging	0.69
IGL02940:Tenm2	APN	11	36041644	missense	probably damaging	1.00
IGL03202:Tenm2	APN	11	36024548	missense	probably damaging	1.00
IGL03213:Tenm2	APN	11	36023330	missense	probably benign	0.05
IGL03276:Tenm2	APN	11	36072776	missense	possibly damaging	0.95
IGL03296:Tenm2	APN	11	36052025	splice site	probably null
IGL03381:Tenm2	APN	11	36068411	missense	probably benign	0.01
IGL03398:Tenm2	APN	11	36024543	missense	probably damaging	1.00
browser	UTSW	11	36046765	critical splice donor site	probably null
mosaic	UTSW	11	36063775	critical splice donor site	probably null
IGL02799:Tenm2	UTSW	11	36273408	missense	probably damaging	1.00
PIT4260001:Tenm2	UTSW	11	36163730	missense	probably damaging	1.00
PIT4382001:Tenm2	UTSW	11	36063902	missense	probably damaging	0.99
R0004:Tenm2	UTSW	11	36023357	missense	probably damaging	1.00
R0420:Tenm2	UTSW	11	36207124	splice site	probably benign
R0537:Tenm2	UTSW	11	36163730	missense	probably damaging	1.00
R0599:Tenm2	UTSW	11	36024780	missense	possibly damaging	0.93
R0636:Tenm2	UTSW	11	36943976	missense	probably damaging	1.00
R0693:Tenm2	UTSW	11	36024809	missense	probably damaging	1.00
R0991:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R0992:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1167:Tenm2	UTSW	11	36864684	missense	probably benign	0.30
R1177:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1178:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1179:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1180:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1181:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1193:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1194:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1195:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1195:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1195:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1259:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1265:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1267:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1268:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1269:Tenm2	UTSW	11	36008358	missense	possibly damaging	0.64
R1270:Tenm2	UTSW	11	36041659	missense	probably damaging	1.00
R1272:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1273:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1311:Tenm2	UTSW	11	36068594	splice site	probably benign
R1374:Tenm2	UTSW	11	36008454	missense	probably benign	0.00
R1542:Tenm2	UTSW	11	36300220	missense	probably damaging	0.99
R1573:Tenm2	UTSW	11	36047069	missense	probably damaging	1.00
R1579:Tenm2	UTSW	11	36106783	missense	probably damaging	1.00
R1697:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1722:Tenm2	UTSW	11	36008103	missense	probably damaging	1.00
R1756:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1793:Tenm2	UTSW	11	36023382	missense	probably damaging	0.99
R1950:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1954:Tenm2	UTSW	11	36047547	missense	possibly damaging	0.87
R2117:Tenm2	UTSW	11	36024854	missense	probably damaging	1.00
R2244:Tenm2	UTSW	11	36864862	missense	probably damaging	0.98
R2298:Tenm2	UTSW	11	36046777	missense	possibly damaging	0.62
R2432:Tenm2	UTSW	11	36027191	missense	probably damaging	1.00
R3014:Tenm2	UTSW	11	36023973	missense	probably damaging	1.00
R3115:Tenm2	UTSW	11	36023366	missense	probably damaging	1.00
R3684:Tenm2	UTSW	11	36051817	missense	probably benign	0.00
R3685:Tenm2	UTSW	11	36051817	missense	probably benign	0.00
R3705:Tenm2	UTSW	11	36068326	missense	probably damaging	0.97
R3820:Tenm2	UTSW	11	36024320	missense	probably damaging	0.98
R3821:Tenm2	UTSW	11	36024320	missense	probably damaging	0.98
R3822:Tenm2	UTSW	11	36024320	missense	probably damaging	0.98
R3844:Tenm2	UTSW	11	36047538	missense	probably damaging	0.98
R3878:Tenm2	UTSW	11	36139574	critical splice donor site	probably null
R4019:Tenm2	UTSW	11	36047074	missense	probably benign	0.04
R4062:Tenm2	UTSW	11	36008655	missense	probably damaging	1.00
R4367:Tenm2	UTSW	11	36027398	missense	probably benign
R4395:Tenm2	UTSW	11	36024624	missense	probably benign	0.23
R4508:Tenm2	UTSW	11	36008345	missense	possibly damaging	0.82
R4534:Tenm2	UTSW	11	36063104	missense	possibly damaging	0.64
R4539:Tenm2	UTSW	11	36046780	missense	probably damaging	1.00
R4644:Tenm2	UTSW	11	36047136	missense	probably benign	0.00
R4661:Tenm2	UTSW	11	36024448	missense	probably damaging	0.99
R4669:Tenm2	UTSW	11	36010487	missense	probably damaging	1.00
R4687:Tenm2	UTSW	11	36049097	missense	probably benign
R4711:Tenm2	UTSW	11	36300212	missense	probably damaging	0.98
R4816:Tenm2	UTSW	11	36027290	missense	probably damaging	1.00
R4843:Tenm2	UTSW	11	36024020	missense	probably damaging	1.00
R4850:Tenm2	UTSW	11	36023488	nonsense	probably null
R4870:Tenm2	UTSW	11	36078569	missense	probably damaging	1.00
R5058:Tenm2	UTSW	11	36207080	missense	possibly damaging	0.80
R5071:Tenm2	UTSW	11	36068381	missense	probably damaging	0.99
R5073:Tenm2	UTSW	11	36068381	missense	probably damaging	0.99
R5074:Tenm2	UTSW	11	36068381	missense	probably damaging	0.99
R5081:Tenm2	UTSW	11	36024633	missense	possibly damaging	0.95
R5093:Tenm2	UTSW	11	36944162	missense	probably damaging	1.00
R5170:Tenm2	UTSW	11	36024806	missense	probably damaging	0.98
R5253:Tenm2	UTSW	11	36047201	nonsense	probably null
R5343:Tenm2	UTSW	11	36069503	missense	probably benign	0.00
R5493:Tenm2	UTSW	11	36864676	missense	probably benign	0.01
R5600:Tenm2	UTSW	11	36163714	splice site	probably null
R5677:Tenm2	UTSW	11	36141683	missense	probably damaging	0.98
R5703:Tenm2	UTSW	11	36023799	missense	probably benign	0.34
R5707:Tenm2	UTSW	11	36047182	missense	possibly damaging	0.79
R6026:Tenm2	UTSW	11	36072729	critical splice donor site	probably null
R6063:Tenm2	UTSW	11	36163717	critical splice donor site	probably null
R6086:Tenm2	UTSW	11	36008646	missense	possibly damaging	0.64
R6151:Tenm2	UTSW	11	36008783	missense	probably damaging	1.00
R6169:Tenm2	UTSW	11	36139690	missense	probably damaging	0.99
R6193:Tenm2	UTSW	11	36046794	missense	probably damaging	1.00
R6405:Tenm2	UTSW	11	36864859	missense	probably benign	0.44
R6477:Tenm2	UTSW	11	36010507	critical splice acceptor site	probably null
R6607:Tenm2	UTSW	11	36063775	critical splice donor site	probably null
R6668:Tenm2	UTSW	11	36046765	critical splice donor site	probably null
R6825:Tenm2	UTSW	11	36046884	missense	probably benign	0.02
R6885:Tenm2	UTSW	11	36023580	missense	possibly damaging	0.95
R7017:Tenm2	UTSW	11	36171409	missense	probably damaging	0.98
R7115:Tenm2	UTSW	11	36163817	missense	probably damaging	0.99
R7153:Tenm2	UTSW	11	36024182	missense	probably damaging	0.98
R7173:Tenm2	UTSW	11	36041551	missense	probably damaging	0.99
R7199:Tenm2	UTSW	11	36171436	missense	probably damaging	1.00
R7205:Tenm2	UTSW	11	36049129	missense	probably damaging	0.99
R7250:Tenm2	UTSW	11	36072798	missense	probably damaging	1.00
R7290:Tenm2	UTSW	11	36023471	missense	probably damaging	1.00
R7366:Tenm2	UTSW	11	36069414	missense	probably benign	0.09
R7432:Tenm2	UTSW	11	36864941	missense	probably benign
R7504:Tenm2	UTSW	11	36139743	missense	probably damaging	1.00
R7513:Tenm2	UTSW	11	36051900	missense	probably benign	0.34
R7523:Tenm2	UTSW	11	36078581	splice site	probably null
R7527:Tenm2	UTSW	11	36206976	missense	probably damaging	1.00
R7648:Tenm2	UTSW	11	36106736	missense	probably damaging	1.00
R7653:Tenm2	UTSW	11	36047347	missense	probably benign	0.09
R7717:Tenm2	UTSW	11	36864935	missense	probably damaging	0.97
R7739:Tenm2	UTSW	11	36069561	missense	possibly damaging	0.50
R7762:Tenm2	UTSW	11	36023306	missense	possibly damaging	0.74
R7786:Tenm2	UTSW	11	36010449	missense	probably damaging	0.99
R7803:Tenm2	UTSW	11	36047116	missense	probably damaging	0.98
R7834:Tenm2	UTSW	11	36024854	missense	probably damaging	1.00
R7838:Tenm2	UTSW	11	36106799	missense	probably benign	0.02
R8073:Tenm2	UTSW	11	36139644	missense	possibly damaging	0.56
R8076:Tenm2	UTSW	11	36027221	missense	probably benign	0.23
R8109:Tenm2	UTSW	11	36008310	missense	probably benign
R8306:Tenm2	UTSW	11	36069369	missense	possibly damaging	0.52
R8352:Tenm2	UTSW	11	36023601	missense	probably damaging	0.98
R8452:Tenm2	UTSW	11	36023601	missense	probably damaging	0.98
R8864:Tenm2	UTSW	11	36027195	missense	possibly damaging	0.95
R8880:Tenm2	UTSW	11	36051961	missense	probably damaging	0.99
R8943:Tenm2	UTSW	11	36944034	missense	probably damaging	0.98
R8969:Tenm2	UTSW	11	36051861	missense	probably damaging	0.99
R9168:Tenm2	UTSW	11	36039895	missense	probably damaging	1.00
R9279:Tenm2	UTSW	11	36068476	missense	probably benign	0.00
R9294:Tenm2	UTSW	11	36024500	missense	probably damaging	0.98
R9320:Tenm2	UTSW	11	36023647	missense	probably damaging	0.99
R9373:Tenm2	UTSW	11	36039886	missense	probably damaging	1.00
R9408:Tenm2	UTSW	11	36069419	missense	probably damaging	1.00
R9410:Tenm2	UTSW	11	36141569	missense	probably damaging	0.99
R9454:Tenm2	UTSW	11	36221459	missense	probably benign
R9489:Tenm2	UTSW	11	36943964	missense	probably damaging	0.99
R9711:Tenm2	UTSW	11	36024514	missense	probably damaging	0.99
RF021:Tenm2	UTSW	11	36024203	missense	possibly damaging	0.95
X0018:Tenm2	UTSW	11	36024200	missense	probably damaging	1.00
X0063:Tenm2	UTSW	11	36024730	missense	probably benign
Z1088:Tenm2	UTSW	11	36273267	missense	probably damaging	1.00
Z1177:Tenm2	UTSW	11	36008234	missense	possibly damaging	0.95
Z1177:Tenm2	UTSW	11	36300335	missense	probably damaging	0.98
Z1177:Tenm2	UTSW	11	36385130	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TTGTACAAGTACTCCCCAGTCACC -3'
(R):5'- TTTCTCACACTGGGGTGCTC -3'

Sequencing Primer
(F):5'- GACTCACAGTGTACTGATGGATACC -3'
(R):5'- TGCTCTACATCACTGAGACGG -3'

Posted On

2014-08-25