Mutagenetix > Incidental Mutation

Incidental Mutation 'R2025:Igf2bp1'

220492

Institutional Source

Beutler Lab

Gene Symbol

Igf2bp1

Ensembl Gene

ENSMUSG00000013415

Gene Name

insulin-like growth factor 2 mRNA binding protein 1

Synonyms

IMP-1, Zbp1, D030026A21Rik, D11Moh45, CRD-BP, D11Moh40e, Crdbp

MMRRC Submission

040034-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.273) question?

Stock #

R2025 (G1)

Quality Score

194

Status

Not validated

Chromosome

Chromosomal Location

95957163-96005940 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 95974170 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 151 (V151A)

Ref Sequence

ENSEMBL: ENSMUSP00000013559 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000013559]

AlphaFold

O88477

Predicted Effect

possibly damaging
Transcript: ENSMUST00000013559
AA Change: V151A

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000013559
Gene: ENSMUSG00000013415
AA Change: V151A

Domain	Start	End	E-Value	Type
RRM	3	71	7.42e-9	SMART
RRM	82	152	5.25e-9	SMART
KH	194	265	7.75e-14	SMART
KH	275	348	7.34e-15	SMART
low complexity region	377	390	N/A	INTRINSIC
KH	404	475	1.91e-13	SMART
KH	486	558	1.42e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141515

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146586

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152896

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the insulin-like growth factor 2 mRNA-binding protein family. The protein encoded by this gene contains four K homology domains and two RNA recognition motifs. It functions by binding to the mRNAs of certain genes, including insulin-like growth factor 2, beta-actin and beta-transducin repeat-containing protein, and regulating their translation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous mutation of this locus results in increased neonatal lethality, growth retardation, and impaired intestinal development. Males exhibit increased anxiety-like response and decreased exploratory behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8030411F24Rik	T	C	2: 148,782,228	F41L	probably damaging	Het
Abcc4	T	C	14: 118,553,325	M757V	probably benign	Het
Acan	T	G	7: 79,101,222	S1914A	probably benign	Het
Axin2	T	A	11: 108,943,078	V617D	probably damaging	Het
Bhlhe22	A	G	3: 18,055,811	S342G	probably benign	Het
Cald1	AAGAGAGAGAGAGAG	AAGAGAGAGAGAG	6: 34,746,173		probably null	Het
Ccdc34	A	G	2: 110,032,386	K179E	possibly damaging	Het
Clasp1	A	G	1: 118,504,899	T208A	probably damaging	Het
Crabp1	C	T	9: 54,768,468	R112*	probably null	Het
D130040H23Rik	A	G	8: 69,302,873	N310S	probably benign	Het
Dalrd3	T	C	9: 108,571,085	I278T	probably benign	Het
Dbp	C	A	7: 45,708,276	D89E	probably benign	Het
Dennd2c	A	G	3: 103,131,689	D51G	possibly damaging	Het
Dido1	A	T	2: 180,689,181	L158*	probably null	Het
Disp1	G	T	1: 183,088,203	F884L	probably damaging	Het
Dmrtb1	T	C	4: 107,683,585	D193G	probably damaging	Het
Dnah8	A	G	17: 30,731,159	D1984G	probably damaging	Het
Dpf2	T	C	19: 5,902,753	Y218C	possibly damaging	Het
Dsg4	C	T	18: 20,466,636	Q770*	probably null	Het
Efemp1	A	T	11: 28,914,696	Y250F	possibly damaging	Het
Erbin	A	T	13: 103,830,195	I1249N	probably benign	Het
F5	A	G	1: 164,209,475	K1928E	probably benign	Het
Fam160a2	A	G	7: 105,388,936	V260A	probably damaging	Het
Fam206a	T	A	4: 56,805,916	I138N	probably damaging	Het
Gdf11	T	A	10: 128,891,445	I81F	probably damaging	Het
Gm10518	T	A	1: 179,803,918		probably benign	Het
Gm14685	G	T	X: 73,127,655	G218C	probably damaging	Het
Grb10	G	C	11: 11,970,576	S14*	probably null	Het
Greb1l	A	T	18: 10,515,221	Y562F	possibly damaging	Het
Gtf2ird1	T	C	5: 134,363,934	E789G	probably damaging	Het
Hook3	T	C	8: 26,038,098	E588G	probably damaging	Het
Hpx	A	G	7: 105,595,104	S266P	probably damaging	Het
Hs6st3	A	G	14: 119,869,389	D403G	probably damaging	Het
Itga11	C	T	9: 62,762,811	T739I	probably damaging	Het
Kalrn	T	C	16: 34,189,736	I702V	probably damaging	Het
Kif2b	C	T	11: 91,577,346	S37N	probably damaging	Het
Kng2	T	A	16: 23,000,575	D237V	probably benign	Het
Krtap27-1	C	A	16: 88,671,285	V124L	possibly damaging	Het
Lig4	A	T	8: 9,972,436	L448Q	probably damaging	Het
Macf1	C	T	4: 123,371,918	A4821T	probably damaging	Het
Msh5	T	A	17: 35,032,792	I431F	possibly damaging	Het
Ndufa10	A	G	1: 92,439,892	Y339H	probably damaging	Het
Nin	T	A	12: 70,030,008	Q1091L	probably damaging	Het
Nom1	A	C	5: 29,446,851	D729A	probably damaging	Het
Olfr671	C	A	7: 104,975,244	G247V	probably benign	Het
P2ry14	A	T	3: 59,115,445	V207E	probably damaging	Het
Pdss2	A	T	10: 43,393,875	N238I	possibly damaging	Het
Pkn1	A	G	8: 83,671,378	V795A	probably damaging	Het
Pla2g6	A	C	15: 79,286,764	L804R	probably damaging	Het
Poglut1	A	T	16: 38,537,905		probably null	Het
Prkcz	A	T	4: 155,289,710	V83D	probably damaging	Het
Prss50	T	C	9: 110,861,260	F157S	probably benign	Het
Psors1c2	A	G	17: 35,534,202		probably benign	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rab7	G	A	6: 88,004,179	L174F	probably damaging	Het
Rapgef4	A	G	2: 72,242,739	T790A	probably benign	Het
Rb1cc1	G	T	1: 6,245,309	V503L	probably damaging	Het
Sbf1	T	A	15: 89,302,730	E815V	probably damaging	Het
Setd3	T	A	12: 108,160,267	E104V	probably damaging	Het
Slc39a5	A	T	10: 128,398,410	L208Q	probably damaging	Het
Slc39a5	G	T	10: 128,398,411	L208M	probably damaging	Het
Slc3a1	T	G	17: 85,032,845	Y232D	probably damaging	Het
Slc8a1	T	A	17: 81,649,112	S166C	probably damaging	Het
Stard9	T	A	2: 120,702,398	D3045E	probably benign	Het
Stk4	C	A	2: 164,096,831	D206E	probably damaging	Het
Syn3	T	C	10: 86,466,982	D103G	probably damaging	Het
Tbc1d30	T	A	10: 121,279,146	Y369F	probably benign	Het
Tenm2	G	T	11: 36,047,264	Y1527*	probably null	Het
Tfg	T	C	16: 56,705,625	K85R	possibly damaging	Het
Timp3	T	C	10: 86,300,885	L11P	probably damaging	Het
Tmem144	A	T	3: 79,827,711		probably null	Het
Tmtc4	T	C	14: 122,921,265	N682S	probably benign	Het
Tnks2	C	T	19: 36,866,066	L464F	probably damaging	Het
Trank1	T	C	9: 111,392,039	F2615L	probably benign	Het
Trio	T	C	15: 27,744,137	K2570E	probably damaging	Het
Trio	T	A	15: 27,773,927	D673V	probably damaging	Het
Ublcp1	A	T	11: 44,465,631	C87S	probably benign	Het
Unc13a	C	T	8: 71,639,768	E1386K	possibly damaging	Het
Wdr41	C	T	13: 95,018,948	H404Y	probably damaging	Het
Zfp280b	T	C	10: 76,038,494	L69S	probably damaging	Het
Zfp346	T	C	13: 55,132,308	S282P	probably damaging	Het
Zfp579	C	A	7: 4,993,521	E464*	probably null	Het
Zfp78	T	A	7: 6,375,514		probably null	Het
Zswim9	T	C	7: 13,269,366	E186G	probably damaging	Het

Other mutations in Igf2bp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02554:Igf2bp1	APN	11	95974168	missense	probably damaging	0.97
IGL03263:Igf2bp1	APN	11	95966673	missense	probably damaging	1.00
R0011:Igf2bp1	UTSW	11	96005584	missense	probably damaging	0.96
R0011:Igf2bp1	UTSW	11	96005584	missense	probably damaging	0.96
R0098:Igf2bp1	UTSW	11	95973163	missense	probably damaging	1.00
R0348:Igf2bp1	UTSW	11	95968893	missense	possibly damaging	0.59
R0534:Igf2bp1	UTSW	11	95966796	splice site	probably benign
R2026:Igf2bp1	UTSW	11	95974170	missense	possibly damaging	0.95
R2103:Igf2bp1	UTSW	11	95975296	missense	probably damaging	0.96
R2104:Igf2bp1	UTSW	11	95975296	missense	probably damaging	0.96
R5021:Igf2bp1	UTSW	11	95974006	missense	probably damaging	0.98
R5154:Igf2bp1	UTSW	11	95963547	nonsense	probably null
R6123:Igf2bp1	UTSW	11	95975296	missense	probably damaging	0.96
R6130:Igf2bp1	UTSW	11	95974020	missense	probably damaging	1.00
R6736:Igf2bp1	UTSW	11	95973122	missense	probably benign	0.14
R7173:Igf2bp1	UTSW	11	95968464	missense	probably benign
R7748:Igf2bp1	UTSW	11	95967587	missense	probably benign	0.03
R8722:Igf2bp1	UTSW	11	95970780	missense	possibly damaging	0.65

Predicted Primers

PCR Primer
(F):5'- CTCCTTGCCAATGATAGCGC -3'
(R):5'- ACGTTCCCTAGTGATGGAGGTG -3'

Sequencing Primer
(F):5'- TGATAGCGCCTACATACTGCGTAG -3'
(R):5'- TAGGAGACAGATGGTTAGCTCCAC -3'

Posted On

2014-08-25