Incidental Mutation 'R2025:Nin'
ID 220496
Institutional Source Beutler Lab
Gene Symbol Nin
Ensembl Gene ENSMUSG00000021068
Gene Name ninein
Synonyms 3110068G20Rik
MMRRC Submission 040034-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2025 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 70058209-70160491 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 70076782 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 1091 (Q1091L)
Ref Sequence ENSEMBL: ENSMUSP00000152530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021468] [ENSMUST00000085314] [ENSMUST00000095666] [ENSMUST00000169074] [ENSMUST00000220689] [ENSMUST00000222237] [ENSMUST00000223257] [ENSMUST00000222835]
AlphaFold Q61043
Predicted Effect probably damaging
Transcript: ENSMUST00000021468
AA Change: Q1798L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021468
Gene: ENSMUSG00000021068
AA Change: Q1798L

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000085314
AA Change: Q1798L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000082422
Gene: ENSMUSG00000021068
AA Change: Q1798L

DomainStartEndE-ValueType
internal_repeat_1 7 67 4.15e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 4.15e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1971 2045 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000095666
AA Change: Q1798L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000093327
Gene: ENSMUSG00000021068
AA Change: Q1798L

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169074
AA Change: Q1798L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129648
Gene: ENSMUSG00000021068
AA Change: Q1798L

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000220689
AA Change: Q1091L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221486
Predicted Effect probably damaging
Transcript: ENSMUST00000222237
AA Change: Q1798L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000223257
AA Change: Q1798L

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223048
Predicted Effect probably benign
Transcript: ENSMUST00000222835
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223469
Predicted Effect probably benign
Transcript: ENSMUST00000221579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222137
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the proteins important for centrosomal function. This protein is important for positioning and anchoring the microtubules minus-ends in epithelial cells. Localization of this protein to the centrosome requires three leucine zippers in the central coiled-coil domain. Multiple alternatively spliced transcript variants that encode different isoforms have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 T C 14: 118,790,737 (GRCm39) M757V probably benign Het
Abitram T A 4: 56,805,916 (GRCm39) I138N probably damaging Het
Acan T G 7: 78,750,970 (GRCm39) S1914A probably benign Het
Axin2 T A 11: 108,833,904 (GRCm39) V617D probably damaging Het
Bhlhe22 A G 3: 18,109,975 (GRCm39) S342G probably benign Het
Cald1 AAGAGAGAGAGAGAG AAGAGAGAGAGAG 6: 34,723,108 (GRCm39) probably null Het
Ccdc34 A G 2: 109,862,731 (GRCm39) K179E possibly damaging Het
Clasp1 A G 1: 118,432,629 (GRCm39) T208A probably damaging Het
Crabp1 C T 9: 54,675,752 (GRCm39) R112* probably null Het
Cstdc1 T C 2: 148,624,148 (GRCm39) F41L probably damaging Het
D130040H23Rik A G 8: 69,755,525 (GRCm39) N310S probably benign Het
Dalrd3 T C 9: 108,448,284 (GRCm39) I278T probably benign Het
Dbp C A 7: 45,357,700 (GRCm39) D89E probably benign Het
Dennd2c A G 3: 103,039,005 (GRCm39) D51G possibly damaging Het
Dido1 A T 2: 180,330,974 (GRCm39) L158* probably null Het
Disp1 G T 1: 182,869,767 (GRCm39) F884L probably damaging Het
Dmrtb1 T C 4: 107,540,782 (GRCm39) D193G probably damaging Het
Dnah8 A G 17: 30,950,133 (GRCm39) D1984G probably damaging Het
Dpf2 T C 19: 5,952,781 (GRCm39) Y218C possibly damaging Het
Dsg4 C T 18: 20,599,693 (GRCm39) Q770* probably null Het
Efemp1 A T 11: 28,864,696 (GRCm39) Y250F possibly damaging Het
Erbin A T 13: 103,966,703 (GRCm39) I1249N probably benign Het
F5 A G 1: 164,037,044 (GRCm39) K1928E probably benign Het
Fhip1b A G 7: 105,038,143 (GRCm39) V260A probably damaging Het
Gdf11 T A 10: 128,727,314 (GRCm39) I81F probably damaging Het
Gm10518 T A 1: 179,631,483 (GRCm39) probably benign Het
Grb10 G C 11: 11,920,576 (GRCm39) S14* probably null Het
Greb1l A T 18: 10,515,221 (GRCm39) Y562F possibly damaging Het
Gtf2ird1 T C 5: 134,392,788 (GRCm39) E789G probably damaging Het
Hook3 T C 8: 26,528,126 (GRCm39) E588G probably damaging Het
Hpx A G 7: 105,244,311 (GRCm39) S266P probably damaging Het
Hs6st3 A G 14: 120,106,801 (GRCm39) D403G probably damaging Het
Igf2bp1 A G 11: 95,864,996 (GRCm39) V151A possibly damaging Het
Itga11 C T 9: 62,670,093 (GRCm39) T739I probably damaging Het
Kalrn T C 16: 34,010,106 (GRCm39) I702V probably damaging Het
Kif2b C T 11: 91,468,172 (GRCm39) S37N probably damaging Het
Kng2 T A 16: 22,819,325 (GRCm39) D237V probably benign Het
Krtap27-1 C A 16: 88,468,173 (GRCm39) V124L possibly damaging Het
Lig4 A T 8: 10,022,436 (GRCm39) L448Q probably damaging Het
Macf1 C T 4: 123,265,711 (GRCm39) A4821T probably damaging Het
Msh5 T A 17: 35,251,768 (GRCm39) I431F possibly damaging Het
Ndufa10 A G 1: 92,367,614 (GRCm39) Y339H probably damaging Het
Nom1 A C 5: 29,651,849 (GRCm39) D729A probably damaging Het
Or52e8 C A 7: 104,624,451 (GRCm39) G247V probably benign Het
P2ry14 A T 3: 59,022,866 (GRCm39) V207E probably damaging Het
Pdss2 A T 10: 43,269,871 (GRCm39) N238I possibly damaging Het
Pkn1 A G 8: 84,398,007 (GRCm39) V795A probably damaging Het
Pla2g6 A C 15: 79,170,964 (GRCm39) L804R probably damaging Het
Poglut1 A T 16: 38,358,267 (GRCm39) probably null Het
Prkcz A T 4: 155,374,167 (GRCm39) V83D probably damaging Het
Prss50 T C 9: 110,690,328 (GRCm39) F157S probably benign Het
Psors1c2 A G 17: 35,845,099 (GRCm39) probably benign Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Pwwp4a G T X: 72,171,261 (GRCm39) G218C probably damaging Het
Rab7 G A 6: 87,981,161 (GRCm39) L174F probably damaging Het
Rapgef4 A G 2: 72,073,083 (GRCm39) T790A probably benign Het
Rb1cc1 G T 1: 6,315,533 (GRCm39) V503L probably damaging Het
Sbf1 T A 15: 89,186,933 (GRCm39) E815V probably damaging Het
Setd3 T A 12: 108,126,526 (GRCm39) E104V probably damaging Het
Slc39a5 A T 10: 128,234,279 (GRCm39) L208Q probably damaging Het
Slc39a5 G T 10: 128,234,280 (GRCm39) L208M probably damaging Het
Slc3a1 T G 17: 85,340,273 (GRCm39) Y232D probably damaging Het
Slc8a1 T A 17: 81,956,541 (GRCm39) S166C probably damaging Het
Stard9 T A 2: 120,532,879 (GRCm39) D3045E probably benign Het
Stk4 C A 2: 163,938,751 (GRCm39) D206E probably damaging Het
Syn3 T C 10: 86,302,846 (GRCm39) D103G probably damaging Het
Tbc1d30 T A 10: 121,115,051 (GRCm39) Y369F probably benign Het
Tenm2 G T 11: 35,938,091 (GRCm39) Y1527* probably null Het
Tfg T C 16: 56,525,988 (GRCm39) K85R possibly damaging Het
Timp3 T C 10: 86,136,749 (GRCm39) L11P probably damaging Het
Tmem144 A T 3: 79,735,018 (GRCm39) probably null Het
Tmtc4 T C 14: 123,158,677 (GRCm39) N682S probably benign Het
Tnks2 C T 19: 36,843,466 (GRCm39) L464F probably damaging Het
Trank1 T C 9: 111,221,107 (GRCm39) F2615L probably benign Het
Trio T C 15: 27,744,223 (GRCm39) K2570E probably damaging Het
Trio T A 15: 27,774,013 (GRCm39) D673V probably damaging Het
Ublcp1 A T 11: 44,356,458 (GRCm39) C87S probably benign Het
Unc13a C T 8: 72,092,412 (GRCm39) E1386K possibly damaging Het
Wdr41 C T 13: 95,155,456 (GRCm39) H404Y probably damaging Het
Zfp280b T C 10: 75,874,328 (GRCm39) L69S probably damaging Het
Zfp346 T C 13: 55,280,121 (GRCm39) S282P probably damaging Het
Zfp579 C A 7: 4,996,520 (GRCm39) E464* probably null Het
Zfp78 T A 7: 6,378,513 (GRCm39) probably null Het
Zswim9 T C 7: 13,003,292 (GRCm39) E186G probably damaging Het
Other mutations in Nin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Nin APN 12 70,076,862 (GRCm39) missense probably damaging 0.98
IGL00677:Nin APN 12 70,073,634 (GRCm39) missense probably damaging 1.00
IGL00823:Nin APN 12 70,061,567 (GRCm39) missense probably benign 0.01
IGL01103:Nin APN 12 70,103,532 (GRCm39) missense probably damaging 0.99
IGL01113:Nin APN 12 70,078,553 (GRCm39) missense probably damaging 1.00
IGL01420:Nin APN 12 70,092,188 (GRCm39) missense probably benign 0.08
IGL01556:Nin APN 12 70,089,962 (GRCm39) missense probably benign 0.01
IGL01663:Nin APN 12 70,090,439 (GRCm39) missense possibly damaging 0.72
IGL02002:Nin APN 12 70,109,473 (GRCm39) nonsense probably null
IGL02030:Nin APN 12 70,092,042 (GRCm39) missense probably damaging 1.00
IGL02202:Nin APN 12 70,102,210 (GRCm39) missense probably damaging 1.00
IGL02207:Nin APN 12 70,103,431 (GRCm39) missense probably damaging 0.99
IGL02257:Nin APN 12 70,149,465 (GRCm39) missense possibly damaging 0.71
IGL02394:Nin APN 12 70,090,805 (GRCm39) missense probably damaging 1.00
IGL02531:Nin APN 12 70,067,706 (GRCm39) missense probably benign 0.02
IGL03028:Nin APN 12 70,082,044 (GRCm39) missense probably benign 0.13
IGL03155:Nin APN 12 70,078,544 (GRCm39) missense probably damaging 1.00
IGL03197:Nin APN 12 70,073,584 (GRCm39) missense probably benign 0.03
IGL02835:Nin UTSW 12 70,103,512 (GRCm39) missense probably damaging 1.00
R0131:Nin UTSW 12 70,097,915 (GRCm39) missense probably damaging 1.00
R0131:Nin UTSW 12 70,097,915 (GRCm39) missense probably damaging 1.00
R0132:Nin UTSW 12 70,097,915 (GRCm39) missense probably damaging 1.00
R0211:Nin UTSW 12 70,061,649 (GRCm39) missense probably damaging 1.00
R0211:Nin UTSW 12 70,061,649 (GRCm39) missense probably damaging 1.00
R0734:Nin UTSW 12 70,076,887 (GRCm39) missense probably benign 0.01
R0947:Nin UTSW 12 70,107,960 (GRCm39) missense probably damaging 1.00
R1085:Nin UTSW 12 70,067,736 (GRCm39) missense possibly damaging 0.91
R1367:Nin UTSW 12 70,090,703 (GRCm39) missense probably damaging 0.99
R1452:Nin UTSW 12 70,064,424 (GRCm39) nonsense probably null
R1477:Nin UTSW 12 70,090,958 (GRCm39) missense possibly damaging 0.87
R1518:Nin UTSW 12 70,061,547 (GRCm39) missense probably benign 0.27
R1566:Nin UTSW 12 70,101,253 (GRCm39) missense probably damaging 0.99
R1572:Nin UTSW 12 70,085,524 (GRCm39) missense probably damaging 1.00
R1583:Nin UTSW 12 70,078,512 (GRCm39) missense probably benign
R1584:Nin UTSW 12 70,089,443 (GRCm39) missense probably benign 0.03
R1699:Nin UTSW 12 70,092,337 (GRCm39) missense possibly damaging 0.87
R1699:Nin UTSW 12 70,077,712 (GRCm39) missense probably benign 0.40
R1765:Nin UTSW 12 70,089,665 (GRCm39) missense probably damaging 1.00
R1794:Nin UTSW 12 70,090,569 (GRCm39) nonsense probably null
R1952:Nin UTSW 12 70,077,700 (GRCm39) missense probably damaging 1.00
R2004:Nin UTSW 12 70,072,251 (GRCm39) missense probably benign 0.01
R2060:Nin UTSW 12 70,089,192 (GRCm39) missense possibly damaging 0.64
R2213:Nin UTSW 12 70,092,128 (GRCm39) missense probably damaging 1.00
R2224:Nin UTSW 12 70,108,004 (GRCm39) missense probably damaging 1.00
R2247:Nin UTSW 12 70,101,319 (GRCm39) missense probably damaging 1.00
R2972:Nin UTSW 12 70,109,487 (GRCm39) missense probably damaging 1.00
R3776:Nin UTSW 12 70,085,456 (GRCm39) missense possibly damaging 0.71
R3881:Nin UTSW 12 70,089,315 (GRCm39) missense probably benign 0.00
R3930:Nin UTSW 12 70,125,016 (GRCm39) missense probably damaging 1.00
R3959:Nin UTSW 12 70,097,526 (GRCm39) missense probably damaging 1.00
R4229:Nin UTSW 12 70,097,984 (GRCm39) missense probably damaging 0.99
R4359:Nin UTSW 12 70,061,712 (GRCm39) missense probably benign 0.00
R4423:Nin UTSW 12 70,089,752 (GRCm39) missense probably damaging 1.00
R4461:Nin UTSW 12 70,089,359 (GRCm39) missense probably benign 0.37
R4639:Nin UTSW 12 70,085,375 (GRCm39) missense probably damaging 0.97
R4791:Nin UTSW 12 70,090,581 (GRCm39) missense possibly damaging 0.94
R4839:Nin UTSW 12 70,137,325 (GRCm39) missense possibly damaging 0.46
R4912:Nin UTSW 12 70,090,837 (GRCm39) missense probably damaging 1.00
R5712:Nin UTSW 12 70,089,543 (GRCm39) missense probably damaging 1.00
R5726:Nin UTSW 12 70,124,953 (GRCm39) missense probably damaging 1.00
R5804:Nin UTSW 12 70,092,375 (GRCm39) missense possibly damaging 0.58
R5874:Nin UTSW 12 70,077,692 (GRCm39) missense possibly damaging 0.94
R5992:Nin UTSW 12 70,092,298 (GRCm39) missense possibly damaging 0.83
R6077:Nin UTSW 12 70,066,006 (GRCm39) missense probably damaging 1.00
R6184:Nin UTSW 12 70,090,511 (GRCm39) missense probably damaging 1.00
R6307:Nin UTSW 12 70,061,631 (GRCm39) missense possibly damaging 0.91
R6315:Nin UTSW 12 70,092,389 (GRCm39) missense probably damaging 1.00
R6326:Nin UTSW 12 70,091,955 (GRCm39) missense possibly damaging 0.95
R6492:Nin UTSW 12 70,101,308 (GRCm39) missense probably benign 0.22
R6562:Nin UTSW 12 70,102,728 (GRCm39) missense probably damaging 1.00
R6578:Nin UTSW 12 70,107,968 (GRCm39) missense probably damaging 0.99
R6613:Nin UTSW 12 70,077,728 (GRCm39) missense probably damaging 1.00
R7112:Nin UTSW 12 70,149,573 (GRCm39) missense
R7170:Nin UTSW 12 70,091,013 (GRCm39) missense
R7324:Nin UTSW 12 70,090,508 (GRCm39) missense
R7338:Nin UTSW 12 70,090,838 (GRCm39) missense
R7372:Nin UTSW 12 70,102,803 (GRCm39) missense
R7431:Nin UTSW 12 70,124,997 (GRCm39) missense
R7577:Nin UTSW 12 70,109,480 (GRCm39) missense
R7655:Nin UTSW 12 70,089,542 (GRCm39) missense
R7656:Nin UTSW 12 70,089,542 (GRCm39) missense
R7683:Nin UTSW 12 70,124,956 (GRCm39) missense
R7769:Nin UTSW 12 70,090,004 (GRCm39) missense
R7981:Nin UTSW 12 70,089,591 (GRCm39) missense
R8138:Nin UTSW 12 70,089,672 (GRCm39) missense
R8141:Nin UTSW 12 70,076,795 (GRCm39) missense
R8754:Nin UTSW 12 70,077,787 (GRCm39) intron probably benign
R8790:Nin UTSW 12 70,067,793 (GRCm39) missense
R8899:Nin UTSW 12 70,077,710 (GRCm39) missense probably damaging 1.00
R8974:Nin UTSW 12 70,124,932 (GRCm39) missense
R9085:Nin UTSW 12 70,076,786 (GRCm39) nonsense probably null
R9143:Nin UTSW 12 70,137,349 (GRCm39) missense
R9380:Nin UTSW 12 70,074,805 (GRCm39) missense
R9496:Nin UTSW 12 70,102,762 (GRCm39) missense
R9638:Nin UTSW 12 70,067,618 (GRCm39) missense
R9709:Nin UTSW 12 70,149,468 (GRCm39) missense
R9745:Nin UTSW 12 70,089,899 (GRCm39) missense
R9792:Nin UTSW 12 70,094,009 (GRCm39) missense
Z1176:Nin UTSW 12 70,095,938 (GRCm39) critical splice acceptor site probably null
Z1177:Nin UTSW 12 70,101,200 (GRCm39) missense
Z1177:Nin UTSW 12 70,090,869 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- CGTTCGGTTCAGTAGTGGCTAC -3'
(R):5'- TGGACATGCAACAGGTGAGC -3'

Sequencing Primer
(F):5'- CGTGatatacacacacacac -3'
(R):5'- AGCCCATGAATGTGTGTGTCAC -3'
Posted On 2014-08-25