Mutagenetix > Incidental Mutation

Incidental Mutation 'R2025:Ptch1'

220502

Institutional Source

Beutler Lab

Gene Symbol

Ptch1

Ensembl Gene

ENSMUSG00000021466

Gene Name

patched 1

Synonyms

A230106A15Rik, Patched 1, Ptc1, Ptc

MMRRC Submission

040034-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2025 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

63508328-63573598 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 63524959 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Alanine at position 944 (E944A)

Ref Sequence

ENSEMBL: ENSMUSP00000021921 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021921] [ENSMUST00000192155] [ENSMUST00000194663] [ENSMUST00000195258]

AlphaFold

Q61115

Predicted Effect

probably benign
Transcript: ENSMUST00000021921
AA Change: E944A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000021921
Gene: ENSMUSG00000021466
AA Change: E944A

Domain	Start	End	E-Value	Type
low complexity region	4	30	N/A	INTRINSIC
Pfam:Patched	351	871	7.6e-47	PFAM
Pfam:Sterol-sensing	448	602	1.5e-45	PFAM
Pfam:Patched	952	1166	9.8e-33	PFAM
low complexity region	1180	1189	N/A	INTRINSIC
low complexity region	1204	1213	N/A	INTRINSIC
low complexity region	1281	1296	N/A	INTRINSIC
low complexity region	1355	1367	N/A	INTRINSIC
low complexity region	1369	1384	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000192155
AA Change: E807A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000141489
Gene: ENSMUSG00000021466
AA Change: E807A

Domain	Start	End	E-Value	Type
Pfam:Patched	214	733	3.1e-44	PFAM
Pfam:Sterol-sensing	311	465	2.8e-46	PFAM
Pfam:Patched	814	1029	3.1e-30	PFAM
low complexity region	1043	1052	N/A	INTRINSIC
low complexity region	1067	1076	N/A	INTRINSIC
low complexity region	1144	1159	N/A	INTRINSIC
low complexity region	1218	1230	N/A	INTRINSIC
low complexity region	1232	1247	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000194663

SMART Domains

Protein: ENSMUSP00000141766
Gene: ENSMUSG00000021466

Domain	Start	End	E-Value	Type
Pfam:Patched	298	569	4.7e-34	PFAM
Pfam:Sterol-sensing	396	550	7.9e-47	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000195258

SMART Domains

Protein: ENSMUSP00000141309
Gene: ENSMUSG00000021466

Domain	Start	End	E-Value	Type
Pfam:Patched	212	426	7.8e-28	PFAM
Pfam:Sterol-sensing	311	426	8e-33	PFAM

Meta Mutation Damage Score

0.1368

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the patched gene family. The encoded protein is the receptor for sonic hedgehog, a secreted molecule implicated in the formation of embryonic structures and in tumorigenesis, as well as the desert hedgehog and indian hedgehog proteins. This gene functions as a tumor suppressor. Mutations of this gene have been associated with basal cell nevus syndrome, esophageal squamous cell carcinoma, trichoepitheliomas, transitional cell carcinomas of the bladder, as well as holoprosencephaly. Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences and biological validity cannot be determined currently. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die by day 10 with neural tube defects. Heterozygotes are large with excess cerebellar granule cell proliferation and sometimes, hindlimb defects and medulloblastomas. Hypomorphic and spontaneous mutants have reproductive defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8030411F24Rik	T	C	2: 148,782,228	F41L	probably damaging	Het
Abcc4	T	C	14: 118,553,325	M757V	probably benign	Het
Acan	T	G	7: 79,101,222	S1914A	probably benign	Het
Axin2	T	A	11: 108,943,078	V617D	probably damaging	Het
Bhlhe22	A	G	3: 18,055,811	S342G	probably benign	Het
Cald1	AAGAGAGAGAGAGAG	AAGAGAGAGAGAG	6: 34,746,173		probably null	Het
Ccdc34	A	G	2: 110,032,386	K179E	possibly damaging	Het
Clasp1	A	G	1: 118,504,899	T208A	probably damaging	Het
Crabp1	C	T	9: 54,768,468	R112*	probably null	Het
D130040H23Rik	A	G	8: 69,302,873	N310S	probably benign	Het
Dalrd3	T	C	9: 108,571,085	I278T	probably benign	Het
Dbp	C	A	7: 45,708,276	D89E	probably benign	Het
Dennd2c	A	G	3: 103,131,689	D51G	possibly damaging	Het
Dido1	A	T	2: 180,689,181	L158*	probably null	Het
Disp1	G	T	1: 183,088,203	F884L	probably damaging	Het
Dmrtb1	T	C	4: 107,683,585	D193G	probably damaging	Het
Dnah8	A	G	17: 30,731,159	D1984G	probably damaging	Het
Dpf2	T	C	19: 5,902,753	Y218C	possibly damaging	Het
Dsg4	C	T	18: 20,466,636	Q770*	probably null	Het
Efemp1	A	T	11: 28,914,696	Y250F	possibly damaging	Het
Erbin	A	T	13: 103,830,195	I1249N	probably benign	Het
F5	A	G	1: 164,209,475	K1928E	probably benign	Het
Fam160a2	A	G	7: 105,388,936	V260A	probably damaging	Het
Fam206a	T	A	4: 56,805,916	I138N	probably damaging	Het
Gdf11	T	A	10: 128,891,445	I81F	probably damaging	Het
Gm10518	T	A	1: 179,803,918		probably benign	Het
Gm14685	G	T	X: 73,127,655	G218C	probably damaging	Het
Grb10	G	C	11: 11,970,576	S14*	probably null	Het
Greb1l	A	T	18: 10,515,221	Y562F	possibly damaging	Het
Gtf2ird1	T	C	5: 134,363,934	E789G	probably damaging	Het
Hook3	T	C	8: 26,038,098	E588G	probably damaging	Het
Hpx	A	G	7: 105,595,104	S266P	probably damaging	Het
Hs6st3	A	G	14: 119,869,389	D403G	probably damaging	Het
Igf2bp1	A	G	11: 95,974,170	V151A	possibly damaging	Het
Itga11	C	T	9: 62,762,811	T739I	probably damaging	Het
Kalrn	T	C	16: 34,189,736	I702V	probably damaging	Het
Kif2b	C	T	11: 91,577,346	S37N	probably damaging	Het
Kng2	T	A	16: 23,000,575	D237V	probably benign	Het
Krtap27-1	C	A	16: 88,671,285	V124L	possibly damaging	Het
Lig4	A	T	8: 9,972,436	L448Q	probably damaging	Het
Macf1	C	T	4: 123,371,918	A4821T	probably damaging	Het
Msh5	T	A	17: 35,032,792	I431F	possibly damaging	Het
Ndufa10	A	G	1: 92,439,892	Y339H	probably damaging	Het
Nin	T	A	12: 70,030,008	Q1091L	probably damaging	Het
Nom1	A	C	5: 29,446,851	D729A	probably damaging	Het
Olfr671	C	A	7: 104,975,244	G247V	probably benign	Het
P2ry14	A	T	3: 59,115,445	V207E	probably damaging	Het
Pdss2	A	T	10: 43,393,875	N238I	possibly damaging	Het
Pkn1	A	G	8: 83,671,378	V795A	probably damaging	Het
Pla2g6	A	C	15: 79,286,764	L804R	probably damaging	Het
Poglut1	A	T	16: 38,537,905		probably null	Het
Prkcz	A	T	4: 155,289,710	V83D	probably damaging	Het
Prss50	T	C	9: 110,861,260	F157S	probably benign	Het
Psors1c2	A	G	17: 35,534,202		probably benign	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rab7	G	A	6: 88,004,179	L174F	probably damaging	Het
Rapgef4	A	G	2: 72,242,739	T790A	probably benign	Het
Rb1cc1	G	T	1: 6,245,309	V503L	probably damaging	Het
Sbf1	T	A	15: 89,302,730	E815V	probably damaging	Het
Setd3	T	A	12: 108,160,267	E104V	probably damaging	Het
Slc39a5	A	T	10: 128,398,410	L208Q	probably damaging	Het
Slc39a5	G	T	10: 128,398,411	L208M	probably damaging	Het
Slc3a1	T	G	17: 85,032,845	Y232D	probably damaging	Het
Slc8a1	T	A	17: 81,649,112	S166C	probably damaging	Het
Stard9	T	A	2: 120,702,398	D3045E	probably benign	Het
Stk4	C	A	2: 164,096,831	D206E	probably damaging	Het
Syn3	T	C	10: 86,466,982	D103G	probably damaging	Het
Tbc1d30	T	A	10: 121,279,146	Y369F	probably benign	Het
Tenm2	G	T	11: 36,047,264	Y1527*	probably null	Het
Tfg	T	C	16: 56,705,625	K85R	possibly damaging	Het
Timp3	T	C	10: 86,300,885	L11P	probably damaging	Het
Tmem144	A	T	3: 79,827,711		probably null	Het
Tmtc4	T	C	14: 122,921,265	N682S	probably benign	Het
Tnks2	C	T	19: 36,866,066	L464F	probably damaging	Het
Trank1	T	C	9: 111,392,039	F2615L	probably benign	Het
Trio	T	C	15: 27,744,137	K2570E	probably damaging	Het
Trio	T	A	15: 27,773,927	D673V	probably damaging	Het
Ublcp1	A	T	11: 44,465,631	C87S	probably benign	Het
Unc13a	C	T	8: 71,639,768	E1386K	possibly damaging	Het
Wdr41	C	T	13: 95,018,948	H404Y	probably damaging	Het
Zfp280b	T	C	10: 76,038,494	L69S	probably damaging	Het
Zfp346	T	C	13: 55,132,308	S282P	probably damaging	Het
Zfp579	C	A	7: 4,993,521	E464*	probably null	Het
Zfp78	T	A	7: 6,375,514		probably null	Het
Zswim9	T	C	7: 13,269,366	E186G	probably damaging	Het

Other mutations in Ptch1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00567:Ptch1	APN	13	63527175	missense	probably benign	0.00
IGL01084:Ptch1	APN	13	63543637	missense	probably damaging	0.99
IGL01369:Ptch1	APN	13	63511681	missense	probably benign
IGL02260:Ptch1	APN	13	63565352	unclassified	probably benign
IGL02439:Ptch1	APN	13	63545096	missense	probably damaging	1.00
IGL02588:Ptch1	APN	13	63511918	missense	probably benign	0.13
IGL02797:Ptch1	APN	13	63533607	missense	probably benign
R0463:Ptch1	UTSW	13	63520307	missense	probably damaging	0.98
R0539:Ptch1	UTSW	13	63543480	splice site	probably benign
R0657:Ptch1	UTSW	13	63513751	missense	possibly damaging	0.90
R0971:Ptch1	UTSW	13	63539843	missense	probably benign	0.23
R1466:Ptch1	UTSW	13	63524969	missense	probably benign	0.02
R1466:Ptch1	UTSW	13	63524969	missense	probably benign	0.02
R1539:Ptch1	UTSW	13	63541287	missense	probably benign	0.00
R1616:Ptch1	UTSW	13	63539842	missense	possibly damaging	0.96
R1883:Ptch1	UTSW	13	63512027	nonsense	probably null
R1985:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R1986:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2024:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2026:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2027:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2096:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2097:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2100:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2105:Ptch1	UTSW	13	63545245	missense	probably benign
R2165:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2166:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2167:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2168:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2226:Ptch1	UTSW	13	63513671	missense	probably damaging	1.00
R2437:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2504:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2507:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2696:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2698:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2698:Ptch1	UTSW	13	63542224	missense	probably damaging	1.00
R2971:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3410:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3708:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3744:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3745:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3783:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3784:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3785:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3807:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3950:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4013:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4015:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4016:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4017:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4035:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4083:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4084:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4179:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4222:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4348:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4349:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4350:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4351:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4353:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4485:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4595:Ptch1	UTSW	13	63543608	missense	possibly damaging	0.68
R4625:Ptch1	UTSW	13	63523164	missense	probably benign	0.02
R4809:Ptch1	UTSW	13	63513708	missense	probably damaging	0.98
R4904:Ptch1	UTSW	13	63523004	missense	probably damaging	1.00
R4911:Ptch1	UTSW	13	63523052	missense	probably damaging	1.00
R4942:Ptch1	UTSW	13	63525070	missense	probably benign	0.02
R5386:Ptch1	UTSW	13	63545043	missense	probably damaging	0.98
R5447:Ptch1	UTSW	13	63527245	missense	probably benign
R5604:Ptch1	UTSW	13	63525122	missense	probably benign	0.01
R5846:Ptch1	UTSW	13	63565454	unclassified	probably benign
R5926:Ptch1	UTSW	13	63545055	missense	probably benign	0.01
R5945:Ptch1	UTSW	13	63573419	utr 5 prime	probably benign
R5957:Ptch1	UTSW	13	63525115	missense	probably damaging	1.00
R6326:Ptch1	UTSW	13	63543545	missense	probably damaging	1.00
R6358:Ptch1	UTSW	13	63513689	missense	probably damaging	0.96
R6376:Ptch1	UTSW	13	63543608	missense	possibly damaging	0.68
R6599:Ptch1	UTSW	13	63523104	missense	probably damaging	0.98
R6615:Ptch1	UTSW	13	63539830	missense	possibly damaging	0.46
R6965:Ptch1	UTSW	13	63525067	missense	possibly damaging	0.63
R7149:Ptch1	UTSW	13	63511736	missense	probably benign	0.23
R7168:Ptch1	UTSW	13	63512060	missense	probably benign
R7257:Ptch1	UTSW	13	63573294	missense	not run
R7258:Ptch1	UTSW	13	63573294	missense	not run
R7259:Ptch1	UTSW	13	63573294	missense	not run
R7368:Ptch1	UTSW	13	63511984	missense	probably benign	0.06
R7525:Ptch1	UTSW	13	63511714	missense	probably benign	0.00
R7528:Ptch1	UTSW	13	63511714	missense	probably benign	0.00
R7820:Ptch1	UTSW	13	63523061	missense	probably damaging	1.00
R8077:Ptch1	UTSW	13	63540812	missense	probably damaging	0.98
R8373:Ptch1	UTSW	13	63541168	missense	probably damaging	1.00
R8398:Ptch1	UTSW	13	63525125	missense	probably benign	0.06
R8407:Ptch1	UTSW	13	63514243	missense	probably null	1.00
R8839:Ptch1	UTSW	13	63541224	missense	probably damaging	1.00
R9075:Ptch1	UTSW	13	63533521	missense	possibly damaging	0.87
R9476:Ptch1	UTSW	13	63533634	missense	probably benign	0.05
R9514:Ptch1	UTSW	13	63527257	missense	probably benign
R9528:Ptch1	UTSW	13	63513801	missense	probably benign	0.00
R9568:Ptch1	UTSW	13	63542173	missense	probably damaging	0.99
Z1177:Ptch1	UTSW	13	63520279	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GAAACGCTCACTTCTCAACGTG -3'
(R):5'- TAGTTGACTAAACAGCGTCTGG -3'

Sequencing Primer
(F):5'- GCAGGGCTGTGTTCCATTACAC -3'
(R):5'- GTAGACGCAGATGGCATCATTAATCC -3'

Posted On

2014-08-25