Incidental Mutation 'R1985:Psmd11'
ID220513
Institutional Source Beutler Lab
Gene Symbol Psmd11
Ensembl Gene ENSMUSG00000017428
Gene Nameproteasome (prosome, macropain) 26S subunit, non-ATPase, 11
Synonyms1700089D09Rik, 2810055C24Rik, P44.5, C78232, 2610024G20Rik, S9, 1810019E17Rik
MMRRC Submission 039997-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R1985 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location80428615-80473248 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80445263 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 114 (I114F)
Ref Sequence ENSEMBL: ENSMUSP00000133571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017572] [ENSMUST00000172615] [ENSMUST00000172773] [ENSMUST00000172847] [ENSMUST00000173186] [ENSMUST00000173565] [ENSMUST00000173938] [ENSMUST00000174743]
Predicted Effect probably damaging
Transcript: ENSMUST00000017572
AA Change: I114F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000017572
Gene: ENSMUSG00000017428
AA Change: I114F

DomainStartEndE-ValueType
PAM 143 320 1.6e-67 SMART
PINT 321 404 4.34e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147898
Predicted Effect probably benign
Transcript: ENSMUST00000172615
SMART Domains Protein: ENSMUSP00000134129
Gene: ENSMUSG00000017428

DomainStartEndE-ValueType
PDB:3TXN|A 37 106 1e-22 PDB
Blast:PAM 83 106 2e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172773
SMART Domains Protein: ENSMUSP00000134096
Gene: ENSMUSG00000017428

DomainStartEndE-ValueType
PDB:3TXN|A 37 110 7e-24 PDB
Blast:PAM 83 110 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172847
SMART Domains Protein: ENSMUSP00000134136
Gene: ENSMUSG00000017428

DomainStartEndE-ValueType
PDB:3TXN|A 30 99 2e-22 PDB
Blast:PAM 76 99 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173060
SMART Domains Protein: ENSMUSP00000133509
Gene: ENSMUSG00000017428

DomainStartEndE-ValueType
PDB:3TXN|A 29 98 2e-22 PDB
Blast:PAM 75 98 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173186
Predicted Effect probably damaging
Transcript: ENSMUST00000173565
AA Change: I16F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134326
Gene: ENSMUSG00000017428
AA Change: I16F

DomainStartEndE-ValueType
PDB:3TXN|A 1 114 2e-50 PDB
Blast:PAM 45 114 3e-31 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000173938
AA Change: I114F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133571
Gene: ENSMUSG00000017428
AA Change: I114F

DomainStartEndE-ValueType
PAM 143 320 1.6e-67 SMART
PINT 321 404 4.34e-23 SMART
Predicted Effect unknown
Transcript: ENSMUST00000174743
AA Change: H65L
Meta Mutation Damage Score 0.5166 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 94% (76/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. This gene encodes a member of the proteasome subunit S9 family that functions as a non-ATPase subunit of the 19S regulator and is phosphorylated by AMP-activated protein kinase. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190007I07Rik T A 10: 82,620,217 T37S possibly damaging Het
AA792892 A T 5: 94,384,072 I272L probably benign Het
Abhd8 C A 8: 71,463,513 probably benign Het
Adam5 A T 8: 24,746,739 D648E probably benign Het
Akr1d1 A G 6: 37,558,401 D240G probably damaging Het
Ankmy2 A G 12: 36,157,364 H3R possibly damaging Het
Anpep A C 7: 79,840,857 probably null Het
Apobr A G 7: 126,587,731 T20A possibly damaging Het
Atp2a2 A T 5: 122,466,836 Y427N probably benign Het
Camkk2 A C 5: 122,764,127 S40A possibly damaging Het
Camp T C 9: 109,848,429 N112S probably benign Het
Cbx7 A G 15: 79,918,390 S229P probably damaging Het
Cnot2 T C 10: 116,527,876 N41S probably damaging Het
Dchs1 A G 7: 105,772,398 F272L possibly damaging Het
Dct T C 14: 118,036,542 K318E probably benign Het
Dhrs11 A C 11: 84,828,807 L31V probably damaging Het
Dnah7a T C 1: 53,503,934 D2359G probably benign Het
Dnajc7 A G 11: 100,590,892 S305P probably benign Het
Dscc1 CTGAATGAAT CTGAAT 15: 55,080,176 probably benign Het
Fam71b T C 11: 46,407,866 *666Q probably null Het
Flnc A G 6: 29,444,416 probably benign Het
Gm7535 A G 17: 17,911,538 probably benign Het
Grtp1 A G 8: 13,179,376 F313L probably damaging Het
Haus6 T C 4: 86,593,609 Y425C possibly damaging Het
Hdac1 T A 4: 129,528,960 N83Y possibly damaging Het
Hdlbp A G 1: 93,431,118 I237T probably damaging Het
Hfm1 A T 5: 106,898,576 D481E probably damaging Het
Hipk3 T C 2: 104,434,435 I737V probably benign Het
Il23r T A 6: 67,490,668 probably null Het
Il24 G A 1: 130,882,531 T196I probably benign Het
Ints3 C T 3: 90,400,303 probably null Het
Kcna6 T C 6: 126,738,510 E472G probably benign Het
Kcnj16 C T 11: 111,025,583 T357M probably benign Het
Kdm4b T A 17: 56,401,302 V957E probably damaging Het
Kif21b G A 1: 136,147,546 D166N probably damaging Het
Klhl11 G T 11: 100,463,244 Q584K probably benign Het
Krt9 A T 11: 100,189,991 M345K probably benign Het
Lgr5 T C 10: 115,495,245 probably benign Het
Lilr4b A T 10: 51,481,735 Q80L possibly damaging Het
Lrrc69 T C 4: 14,708,669 E225G possibly damaging Het
Ly9 A G 1: 171,599,773 S405P probably damaging Het
Myh2 A G 11: 67,180,914 D519G possibly damaging Het
Nav3 G A 10: 109,770,184 probably benign Het
Nfkb1 G A 3: 135,615,349 T215I possibly damaging Het
Ninj2 A T 6: 120,198,639 probably benign Het
Obsl1 A G 1: 75,505,600 C209R probably damaging Het
Olfr1393 T C 11: 49,280,283 I45T probably damaging Het
Olfr314 A C 11: 58,786,384 D50A probably damaging Het
Olfr531 A T 7: 140,400,800 M82K possibly damaging Het
Olfr539 G A 7: 140,667,821 C171Y probably damaging Het
Olfr619 A T 7: 103,603,672 Y6F probably benign Het
Olfr710 A G 7: 106,944,926 I25T probably benign Het
Otud4 G C 8: 79,640,012 R36P probably damaging Het
Pcnt C T 10: 76,380,337 R2239H possibly damaging Het
Pgbd5 T A 8: 124,370,592 M491L probably benign Het
Pitrm1 A T 13: 6,558,184 D316V probably damaging Het
Plod3 A G 5: 136,990,853 probably null Het
Plppr3 A T 10: 79,867,460 Y63* probably null Het
Prickle2 T C 6: 92,411,452 D323G probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rbp3 T G 14: 33,956,461 S789A probably benign Het
Rfxap C A 3: 54,807,326 R117L probably damaging Het
Rims2 T A 15: 39,345,314 M171K probably damaging Het
Scin A G 12: 40,133,908 probably null Het
Scn11a A G 9: 119,754,678 S1624P probably benign Het
Slc41a3 G A 6: 90,642,228 V330M probably damaging Het
Slc9c1 A G 16: 45,550,106 I237V probably benign Het
Spag6 A G 2: 18,732,119 I218V probably benign Het
Stam2 T C 2: 52,709,626 T257A possibly damaging Het
Tbc1d24 G A 17: 24,207,964 R318* probably null Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Trpm3 T A 19: 22,926,082 Y1069N possibly damaging Het
Tuba8 A G 6: 121,220,520 D47G probably benign Het
Tulp3 A T 6: 128,326,806 S277T probably benign Het
Wdr7 GTT GT 18: 63,760,583 probably null Het
Ybx2 A G 11: 69,936,468 probably null Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp788 T A 7: 41,650,481 I795N probably damaging Het
Other mutations in Psmd11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Psmd11 APN 11 80470384 missense possibly damaging 0.88
IGL03383:Psmd11 APN 11 80469845 missense probably damaging 1.00
R0358:Psmd11 UTSW 11 80462684 splice site probably benign
R0529:Psmd11 UTSW 11 80470689 unclassified probably benign
R1127:Psmd11 UTSW 11 80471584 missense possibly damaging 0.89
R1936:Psmd11 UTSW 11 80428744 missense probably damaging 1.00
R2356:Psmd11 UTSW 11 80428704 missense possibly damaging 0.89
R2994:Psmd11 UTSW 11 80460667 missense probably damaging 1.00
R4898:Psmd11 UTSW 11 80438320 missense probably damaging 1.00
R5173:Psmd11 UTSW 11 80460740 missense probably benign 0.01
R5234:Psmd11 UTSW 11 80428740 missense probably benign 0.05
R5794:Psmd11 UTSW 11 80471492 missense probably benign 0.00
R6169:Psmd11 UTSW 11 80460713 missense probably damaging 1.00
R6266:Psmd11 UTSW 11 80445941 missense probably benign 0.01
R6275:Psmd11 UTSW 11 80438632 intron probably benign
R7121:Psmd11 UTSW 11 80438273 nonsense probably null
R7318:Psmd11 UTSW 11 80456302 missense probably benign 0.29
Z1088:Psmd11 UTSW 11 80471550 frame shift probably null
Z1176:Psmd11 UTSW 11 80428648
Predicted Primers PCR Primer
(F):5'- ACATGTTGAAAATCTTGTGGGC -3'
(R):5'- CCAAGTACAAGCATGATAGCTCATATC -3'

Sequencing Primer
(F):5'- AAATCTTGTGGGCCAGCATC -3'
(R):5'- TCATCCTGAGCTGTAGAATAAGAC -3'
Posted On2014-08-25