Incidental Mutation 'R1985:Dnajc7'
ID220521
Institutional Source Beutler Lab
Gene Symbol Dnajc7
Ensembl Gene ENSMUSG00000014195
Gene NameDnaJ heat shock protein family (Hsp40) member C7
SynonymsmTpr2, Ttc2, 2010003F24Rik, mDj11, 2010004G07Rik
MMRRC Submission 039997-MU
Accession Numbers

Genbank: NM_019795; MGI: 1928373

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1985 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location100582818-100620168 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100590892 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 305 (S305P)
Ref Sequence ENSEMBL: ENSMUSP00000014339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014339] [ENSMUST00000146840]
Predicted Effect probably benign
Transcript: ENSMUST00000014339
AA Change: S305P

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000014339
Gene: ENSMUSG00000014195
AA Change: S305P

DomainStartEndE-ValueType
TPR 28 61 3.39e-7 SMART
TPR 62 95 1.11e-2 SMART
TPR 96 129 4.09e-1 SMART
Blast:TPR 142 175 4e-13 BLAST
Blast:TPR 176 209 1e-13 BLAST
TPR 210 243 2.29e-4 SMART
TPR 256 289 1.11e-2 SMART
TPR 294 327 2.87e-5 SMART
TPR 328 361 1.83e-3 SMART
DnaJ 380 443 2.93e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136199
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137688
Predicted Effect probably benign
Transcript: ENSMUST00000146840
SMART Domains Protein: ENSMUSP00000115438
Gene: ENSMUSG00000014195

DomainStartEndE-ValueType
TPR 12 45 3.39e-7 SMART
TPR 46 79 1.11e-2 SMART
TPR 80 113 4.09e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147403
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148098
Predicted Effect unknown
Transcript: ENSMUST00000155152
AA Change: S257P
SMART Domains Protein: ENSMUSP00000116793
Gene: ENSMUSG00000014195
AA Change: S257P

DomainStartEndE-ValueType
TPR 19 52 3.39e-7 SMART
TPR 53 86 1.11e-2 SMART
Blast:TPR 95 128 1e-13 BLAST
Blast:TPR 129 162 3e-14 BLAST
TPR 163 196 2.29e-4 SMART
TPR 209 242 1.11e-2 SMART
Meta Mutation Damage Score 0.2820 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 94% (76/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNAJ heat shock protein 40 family of proteins that is characterized by two N-terminal tetratricopeptide repeat domains and a C-terminal DNAJ domain. This protein binds the chaperone proteins heat shock proteins 70 and 90 in an ATP-dependent manner and may function as a co-chaperone. Pseudogenes of this gene are found on chromosomes 1 and 6. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Oct 2009]
PHENOTYPE: Male mice homozygous for a knock-out allele exhibit hepatic steatosis and increased serum cholesterol. [provided by MGI curators]
Allele List at MGI

All alleles(178) : Targeted, other(2) Gene trapped(176)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190007I07Rik T A 10: 82,620,217 T37S possibly damaging Het
AA792892 A T 5: 94,384,072 I272L probably benign Het
Abhd8 C A 8: 71,463,513 probably benign Het
Adam5 A T 8: 24,746,739 D648E probably benign Het
Akr1d1 A G 6: 37,558,401 D240G probably damaging Het
Ankmy2 A G 12: 36,157,364 H3R possibly damaging Het
Anpep A C 7: 79,840,857 probably null Het
Apobr A G 7: 126,587,731 T20A possibly damaging Het
Atp2a2 A T 5: 122,466,836 Y427N probably benign Het
Camkk2 A C 5: 122,764,127 S40A possibly damaging Het
Camp T C 9: 109,848,429 N112S probably benign Het
Cbx7 A G 15: 79,918,390 S229P probably damaging Het
Cnot2 T C 10: 116,527,876 N41S probably damaging Het
Dchs1 A G 7: 105,772,398 F272L possibly damaging Het
Dct T C 14: 118,036,542 K318E probably benign Het
Dhrs11 A C 11: 84,828,807 L31V probably damaging Het
Dnah7a T C 1: 53,503,934 D2359G probably benign Het
Dscc1 CTGAATGAAT CTGAAT 15: 55,080,176 probably benign Het
Fam71b T C 11: 46,407,866 *666Q probably null Het
Flnc A G 6: 29,444,416 probably benign Het
Gm7535 A G 17: 17,911,538 probably benign Het
Grtp1 A G 8: 13,179,376 F313L probably damaging Het
Haus6 T C 4: 86,593,609 Y425C possibly damaging Het
Hdac1 T A 4: 129,528,960 N83Y possibly damaging Het
Hdlbp A G 1: 93,431,118 I237T probably damaging Het
Hfm1 A T 5: 106,898,576 D481E probably damaging Het
Hipk3 T C 2: 104,434,435 I737V probably benign Het
Il23r T A 6: 67,490,668 probably null Het
Il24 G A 1: 130,882,531 T196I probably benign Het
Ints3 C T 3: 90,400,303 probably null Het
Kcna6 T C 6: 126,738,510 E472G probably benign Het
Kcnj16 C T 11: 111,025,583 T357M probably benign Het
Kdm4b T A 17: 56,401,302 V957E probably damaging Het
Kif21b G A 1: 136,147,546 D166N probably damaging Het
Klhl11 G T 11: 100,463,244 Q584K probably benign Het
Krt9 A T 11: 100,189,991 M345K probably benign Het
Lgr5 T C 10: 115,495,245 probably benign Het
Lilr4b A T 10: 51,481,735 Q80L possibly damaging Het
Lrrc69 T C 4: 14,708,669 E225G possibly damaging Het
Ly9 A G 1: 171,599,773 S405P probably damaging Het
Myh2 A G 11: 67,180,914 D519G possibly damaging Het
Nav3 G A 10: 109,770,184 probably benign Het
Nfkb1 G A 3: 135,615,349 T215I possibly damaging Het
Ninj2 A T 6: 120,198,639 probably benign Het
Obsl1 A G 1: 75,505,600 C209R probably damaging Het
Olfr1393 T C 11: 49,280,283 I45T probably damaging Het
Olfr314 A C 11: 58,786,384 D50A probably damaging Het
Olfr531 A T 7: 140,400,800 M82K possibly damaging Het
Olfr539 G A 7: 140,667,821 C171Y probably damaging Het
Olfr619 A T 7: 103,603,672 Y6F probably benign Het
Olfr710 A G 7: 106,944,926 I25T probably benign Het
Otud4 G C 8: 79,640,012 R36P probably damaging Het
Pcnt C T 10: 76,380,337 R2239H possibly damaging Het
Pgbd5 T A 8: 124,370,592 M491L probably benign Het
Pitrm1 A T 13: 6,558,184 D316V probably damaging Het
Plod3 A G 5: 136,990,853 probably null Het
Plppr3 A T 10: 79,867,460 Y63* probably null Het
Prickle2 T C 6: 92,411,452 D323G probably damaging Het
Psmd11 A T 11: 80,445,263 I114F probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rbp3 T G 14: 33,956,461 S789A probably benign Het
Rfxap C A 3: 54,807,326 R117L probably damaging Het
Rims2 T A 15: 39,345,314 M171K probably damaging Het
Scin A G 12: 40,133,908 probably null Het
Scn11a A G 9: 119,754,678 S1624P probably benign Het
Slc41a3 G A 6: 90,642,228 V330M probably damaging Het
Slc9c1 A G 16: 45,550,106 I237V probably benign Het
Spag6 A G 2: 18,732,119 I218V probably benign Het
Stam2 T C 2: 52,709,626 T257A possibly damaging Het
Tbc1d24 G A 17: 24,207,964 R318* probably null Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Trpm3 T A 19: 22,926,082 Y1069N possibly damaging Het
Tuba8 A G 6: 121,220,520 D47G probably benign Het
Tulp3 A T 6: 128,326,806 S277T probably benign Het
Wdr7 GTT GT 18: 63,760,583 probably null Het
Ybx2 A G 11: 69,936,468 probably null Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp788 T A 7: 41,650,481 I795N probably damaging Het
Other mutations in Dnajc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00910:Dnajc7 APN 11 100599191 missense possibly damaging 0.90
IGL00924:Dnajc7 APN 11 100584285 missense possibly damaging 0.81
3-1:Dnajc7 UTSW 11 100589957 missense probably damaging 1.00
R1282:Dnajc7 UTSW 11 100584641 missense probably damaging 1.00
R1587:Dnajc7 UTSW 11 100601730 missense probably damaging 1.00
R1874:Dnajc7 UTSW 11 100599313 splice site probably benign
R4020:Dnajc7 UTSW 11 100591466 missense probably damaging 0.96
R4065:Dnajc7 UTSW 11 100601781 missense probably benign 0.00
R4067:Dnajc7 UTSW 11 100601781 missense probably benign 0.00
R4611:Dnajc7 UTSW 11 100590977 nonsense probably null
R4687:Dnajc7 UTSW 11 100599300 missense probably damaging 1.00
R4716:Dnajc7 UTSW 11 100619576 missense probably benign
R7469:Dnajc7 UTSW 11 100591551 missense probably benign
R7740:Dnajc7 UTSW 11 100591561 missense probably benign 0.01
R7842:Dnajc7 UTSW 11 100598718 missense probably benign 0.42
R7886:Dnajc7 UTSW 11 100601803 missense probably benign 0.00
R7925:Dnajc7 UTSW 11 100598718 missense probably benign 0.42
R7969:Dnajc7 UTSW 11 100601803 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTCACAAGAGACAACTGGGG -3'
(R):5'- TTTGCACTGAACTGACCGTCC -3'

Sequencing Primer
(F):5'- CTCACAAGAGACAACTGGGGAAAAC -3'
(R):5'- GAACTGACCGTCCCTTGC -3'
Posted On2014-08-25