Incidental Mutation 'R2025:Sbf1'
ID 220522
Institutional Source Beutler Lab
Gene Symbol Sbf1
Ensembl Gene ENSMUSG00000036529
Gene Name SET binding factor 1
Synonyms B230113C15Rik, 2610510A08Rik, Mtmr5
MMRRC Submission 040034-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.558) question?
Stock # R2025 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 89172439-89199514 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 89186933 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 815 (E815V)
Ref Sequence ENSEMBL: ENSMUSP00000118107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123791] [ENSMUST00000124576] [ENSMUST00000144585] [ENSMUST00000146637]
AlphaFold Q6ZPE2
PDB Structure Solution Structure of the C-terminal Pleckstrin Homology Domain of Sbf1 from Mouse [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000123791
AA Change: E815V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120725
Gene: ENSMUSG00000036529
AA Change: E815V

DomainStartEndE-ValueType
uDENN 1 86 6.68e-31 SMART
DENN 128 310 4.05e-71 SMART
dDENN 363 432 1.28e-18 SMART
Pfam:SBF2 540 764 4.1e-110 PFAM
GRAM 882 968 3.93e-12 SMART
Pfam:Myotub-related 1100 1534 6.2e-114 PFAM
low complexity region 1614 1621 N/A INTRINSIC
low complexity region 1652 1666 N/A INTRINSIC
low complexity region 1719 1750 N/A INTRINSIC
PH 1762 1867 6.45e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124576
SMART Domains Protein: ENSMUSP00000115740
Gene: ENSMUSG00000036529

DomainStartEndE-ValueType
uDENN 1 86 6.68e-31 SMART
DENN 128 310 4.05e-71 SMART
Pfam:dDENN 363 403 4.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124642
SMART Domains Protein: ENSMUSP00000119943
Gene: ENSMUSG00000036529

DomainStartEndE-ValueType
Pfam:SBF2 1 94 1.2e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000144585
AA Change: E815V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118107
Gene: ENSMUSG00000036529
AA Change: E815V

DomainStartEndE-ValueType
uDENN 1 86 6.68e-31 SMART
DENN 128 310 4.05e-71 SMART
dDENN 363 432 1.28e-18 SMART
Pfam:SBF2 542 764 2.3e-108 PFAM
GRAM 882 968 3.93e-12 SMART
Pfam:Myotub-related 1106 1558 5.7e-93 PFAM
low complexity region 1640 1647 N/A INTRINSIC
low complexity region 1678 1692 N/A INTRINSIC
low complexity region 1745 1776 N/A INTRINSIC
PH 1788 1893 6.45e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146637
SMART Domains Protein: ENSMUSP00000122386
Gene: ENSMUSG00000036529

DomainStartEndE-ValueType
DENN 20 210 8.29e-68 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184827
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150539
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protein-tyrosine phosphatase family. However, the encoded protein does not appear to be a catalytically active phosphatase because it lacks several amino acids in the catalytic pocket. This protein contains a Guanine nucleotide exchange factor (GEF) domain which is necessary for its role in growth and differentiation. Mutations in this gene have been associated with Charcot-Marie-Tooth disease 4B3. Pseudogenes of this gene have been defined on chromosomes 1 and 8. [provided by RefSeq, Dec 2014]
PHENOTYPE: Male homozygotes for a targeted null mutation exhibit male infertility associated with azoospermia, vacuolation of Sertoli cells, reduced spermatid formation, and eventual depletion of germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 T C 14: 118,790,737 (GRCm39) M757V probably benign Het
Abitram T A 4: 56,805,916 (GRCm39) I138N probably damaging Het
Acan T G 7: 78,750,970 (GRCm39) S1914A probably benign Het
Axin2 T A 11: 108,833,904 (GRCm39) V617D probably damaging Het
Bhlhe22 A G 3: 18,109,975 (GRCm39) S342G probably benign Het
Cald1 AAGAGAGAGAGAGAG AAGAGAGAGAGAG 6: 34,723,108 (GRCm39) probably null Het
Ccdc34 A G 2: 109,862,731 (GRCm39) K179E possibly damaging Het
Clasp1 A G 1: 118,432,629 (GRCm39) T208A probably damaging Het
Crabp1 C T 9: 54,675,752 (GRCm39) R112* probably null Het
Cstdc1 T C 2: 148,624,148 (GRCm39) F41L probably damaging Het
D130040H23Rik A G 8: 69,755,525 (GRCm39) N310S probably benign Het
Dalrd3 T C 9: 108,448,284 (GRCm39) I278T probably benign Het
Dbp C A 7: 45,357,700 (GRCm39) D89E probably benign Het
Dennd2c A G 3: 103,039,005 (GRCm39) D51G possibly damaging Het
Dido1 A T 2: 180,330,974 (GRCm39) L158* probably null Het
Disp1 G T 1: 182,869,767 (GRCm39) F884L probably damaging Het
Dmrtb1 T C 4: 107,540,782 (GRCm39) D193G probably damaging Het
Dnah8 A G 17: 30,950,133 (GRCm39) D1984G probably damaging Het
Dpf2 T C 19: 5,952,781 (GRCm39) Y218C possibly damaging Het
Dsg4 C T 18: 20,599,693 (GRCm39) Q770* probably null Het
Efemp1 A T 11: 28,864,696 (GRCm39) Y250F possibly damaging Het
Erbin A T 13: 103,966,703 (GRCm39) I1249N probably benign Het
F5 A G 1: 164,037,044 (GRCm39) K1928E probably benign Het
Fhip1b A G 7: 105,038,143 (GRCm39) V260A probably damaging Het
Gdf11 T A 10: 128,727,314 (GRCm39) I81F probably damaging Het
Gm10518 T A 1: 179,631,483 (GRCm39) probably benign Het
Grb10 G C 11: 11,920,576 (GRCm39) S14* probably null Het
Greb1l A T 18: 10,515,221 (GRCm39) Y562F possibly damaging Het
Gtf2ird1 T C 5: 134,392,788 (GRCm39) E789G probably damaging Het
Hook3 T C 8: 26,528,126 (GRCm39) E588G probably damaging Het
Hpx A G 7: 105,244,311 (GRCm39) S266P probably damaging Het
Hs6st3 A G 14: 120,106,801 (GRCm39) D403G probably damaging Het
Igf2bp1 A G 11: 95,864,996 (GRCm39) V151A possibly damaging Het
Itga11 C T 9: 62,670,093 (GRCm39) T739I probably damaging Het
Kalrn T C 16: 34,010,106 (GRCm39) I702V probably damaging Het
Kif2b C T 11: 91,468,172 (GRCm39) S37N probably damaging Het
Kng2 T A 16: 22,819,325 (GRCm39) D237V probably benign Het
Krtap27-1 C A 16: 88,468,173 (GRCm39) V124L possibly damaging Het
Lig4 A T 8: 10,022,436 (GRCm39) L448Q probably damaging Het
Macf1 C T 4: 123,265,711 (GRCm39) A4821T probably damaging Het
Msh5 T A 17: 35,251,768 (GRCm39) I431F possibly damaging Het
Ndufa10 A G 1: 92,367,614 (GRCm39) Y339H probably damaging Het
Nin T A 12: 70,076,782 (GRCm39) Q1091L probably damaging Het
Nom1 A C 5: 29,651,849 (GRCm39) D729A probably damaging Het
Or52e8 C A 7: 104,624,451 (GRCm39) G247V probably benign Het
P2ry14 A T 3: 59,022,866 (GRCm39) V207E probably damaging Het
Pdss2 A T 10: 43,269,871 (GRCm39) N238I possibly damaging Het
Pkn1 A G 8: 84,398,007 (GRCm39) V795A probably damaging Het
Pla2g6 A C 15: 79,170,964 (GRCm39) L804R probably damaging Het
Poglut1 A T 16: 38,358,267 (GRCm39) probably null Het
Prkcz A T 4: 155,374,167 (GRCm39) V83D probably damaging Het
Prss50 T C 9: 110,690,328 (GRCm39) F157S probably benign Het
Psors1c2 A G 17: 35,845,099 (GRCm39) probably benign Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Pwwp4a G T X: 72,171,261 (GRCm39) G218C probably damaging Het
Rab7 G A 6: 87,981,161 (GRCm39) L174F probably damaging Het
Rapgef4 A G 2: 72,073,083 (GRCm39) T790A probably benign Het
Rb1cc1 G T 1: 6,315,533 (GRCm39) V503L probably damaging Het
Setd3 T A 12: 108,126,526 (GRCm39) E104V probably damaging Het
Slc39a5 A T 10: 128,234,279 (GRCm39) L208Q probably damaging Het
Slc39a5 G T 10: 128,234,280 (GRCm39) L208M probably damaging Het
Slc3a1 T G 17: 85,340,273 (GRCm39) Y232D probably damaging Het
Slc8a1 T A 17: 81,956,541 (GRCm39) S166C probably damaging Het
Stard9 T A 2: 120,532,879 (GRCm39) D3045E probably benign Het
Stk4 C A 2: 163,938,751 (GRCm39) D206E probably damaging Het
Syn3 T C 10: 86,302,846 (GRCm39) D103G probably damaging Het
Tbc1d30 T A 10: 121,115,051 (GRCm39) Y369F probably benign Het
Tenm2 G T 11: 35,938,091 (GRCm39) Y1527* probably null Het
Tfg T C 16: 56,525,988 (GRCm39) K85R possibly damaging Het
Timp3 T C 10: 86,136,749 (GRCm39) L11P probably damaging Het
Tmem144 A T 3: 79,735,018 (GRCm39) probably null Het
Tmtc4 T C 14: 123,158,677 (GRCm39) N682S probably benign Het
Tnks2 C T 19: 36,843,466 (GRCm39) L464F probably damaging Het
Trank1 T C 9: 111,221,107 (GRCm39) F2615L probably benign Het
Trio T C 15: 27,744,223 (GRCm39) K2570E probably damaging Het
Trio T A 15: 27,774,013 (GRCm39) D673V probably damaging Het
Ublcp1 A T 11: 44,356,458 (GRCm39) C87S probably benign Het
Unc13a C T 8: 72,092,412 (GRCm39) E1386K possibly damaging Het
Wdr41 C T 13: 95,155,456 (GRCm39) H404Y probably damaging Het
Zfp280b T C 10: 75,874,328 (GRCm39) L69S probably damaging Het
Zfp346 T C 13: 55,280,121 (GRCm39) S282P probably damaging Het
Zfp579 C A 7: 4,996,520 (GRCm39) E464* probably null Het
Zfp78 T A 7: 6,378,513 (GRCm39) probably null Het
Zswim9 T C 7: 13,003,292 (GRCm39) E186G probably damaging Het
Other mutations in Sbf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00265:Sbf1 APN 15 89,189,778 (GRCm39) missense probably damaging 0.98
IGL01478:Sbf1 APN 15 89,183,946 (GRCm39) missense probably damaging 0.97
IGL01533:Sbf1 APN 15 89,172,919 (GRCm39) missense probably damaging 0.99
IGL01603:Sbf1 APN 15 89,187,481 (GRCm39) missense probably damaging 1.00
IGL01758:Sbf1 APN 15 89,187,418 (GRCm39) unclassified probably benign
IGL01908:Sbf1 APN 15 89,186,929 (GRCm39) missense probably damaging 1.00
IGL02067:Sbf1 APN 15 89,173,247 (GRCm39) missense probably damaging 1.00
IGL02089:Sbf1 APN 15 89,186,708 (GRCm39) nonsense probably null
IGL02150:Sbf1 APN 15 89,179,683 (GRCm39) missense probably benign 0.00
IGL02284:Sbf1 APN 15 89,189,281 (GRCm39) missense probably damaging 1.00
IGL02367:Sbf1 APN 15 89,191,775 (GRCm39) missense probably damaging 0.99
IGL02427:Sbf1 APN 15 89,190,188 (GRCm39) unclassified probably benign
IGL03025:Sbf1 APN 15 89,173,848 (GRCm39) missense probably damaging 1.00
IGL03103:Sbf1 APN 15 89,178,150 (GRCm39) missense probably damaging 1.00
IGL03226:Sbf1 APN 15 89,173,308 (GRCm39) missense possibly damaging 0.93
IGL03376:Sbf1 APN 15 89,173,219 (GRCm39) unclassified probably benign
IGL03397:Sbf1 APN 15 89,172,924 (GRCm39) missense probably damaging 1.00
R0043:Sbf1 UTSW 15 89,179,764 (GRCm39) missense probably benign 0.26
R0139:Sbf1 UTSW 15 89,186,701 (GRCm39) missense probably damaging 1.00
R0528:Sbf1 UTSW 15 89,172,915 (GRCm39) missense probably damaging 0.99
R0624:Sbf1 UTSW 15 89,186,532 (GRCm39) missense possibly damaging 0.68
R0759:Sbf1 UTSW 15 89,188,919 (GRCm39) missense probably damaging 1.00
R1555:Sbf1 UTSW 15 89,189,279 (GRCm39) missense probably damaging 1.00
R1763:Sbf1 UTSW 15 89,178,628 (GRCm39) missense probably damaging 1.00
R2207:Sbf1 UTSW 15 89,190,896 (GRCm39) missense possibly damaging 0.88
R2844:Sbf1 UTSW 15 89,187,421 (GRCm39) critical splice donor site probably null
R2845:Sbf1 UTSW 15 89,187,421 (GRCm39) critical splice donor site probably null
R3788:Sbf1 UTSW 15 89,183,731 (GRCm39) nonsense probably null
R4108:Sbf1 UTSW 15 89,172,788 (GRCm39) unclassified probably benign
R4403:Sbf1 UTSW 15 89,178,157 (GRCm39) missense possibly damaging 0.94
R4605:Sbf1 UTSW 15 89,187,684 (GRCm39) missense probably damaging 1.00
R4620:Sbf1 UTSW 15 89,191,129 (GRCm39) missense probably damaging 0.99
R4666:Sbf1 UTSW 15 89,179,449 (GRCm39) missense probably damaging 1.00
R4696:Sbf1 UTSW 15 89,187,315 (GRCm39) nonsense probably null
R4697:Sbf1 UTSW 15 89,199,288 (GRCm39) missense possibly damaging 0.71
R4747:Sbf1 UTSW 15 89,186,916 (GRCm39) missense probably damaging 1.00
R5828:Sbf1 UTSW 15 89,172,837 (GRCm39) missense probably damaging 1.00
R5841:Sbf1 UTSW 15 89,192,271 (GRCm39) missense probably damaging 1.00
R6185:Sbf1 UTSW 15 89,189,814 (GRCm39) missense probably damaging 1.00
R6237:Sbf1 UTSW 15 89,177,679 (GRCm39) missense probably benign 0.29
R6256:Sbf1 UTSW 15 89,185,070 (GRCm39) missense probably benign 0.06
R6490:Sbf1 UTSW 15 89,189,111 (GRCm39) missense probably benign
R6933:Sbf1 UTSW 15 89,184,572 (GRCm39) missense probably damaging 1.00
R7806:Sbf1 UTSW 15 89,189,623 (GRCm39) missense possibly damaging 0.52
R7921:Sbf1 UTSW 15 89,190,426 (GRCm39) missense probably damaging 0.96
R8005:Sbf1 UTSW 15 89,178,408 (GRCm39) missense probably damaging 0.98
R8350:Sbf1 UTSW 15 89,183,712 (GRCm39) missense probably damaging 0.99
R8450:Sbf1 UTSW 15 89,183,712 (GRCm39) missense probably damaging 0.99
R8509:Sbf1 UTSW 15 89,177,660 (GRCm39) missense probably damaging 1.00
R8753:Sbf1 UTSW 15 89,179,662 (GRCm39) missense probably benign
R8788:Sbf1 UTSW 15 89,186,062 (GRCm39) missense probably damaging 1.00
R9182:Sbf1 UTSW 15 89,173,806 (GRCm39) critical splice donor site probably null
R9516:Sbf1 UTSW 15 89,184,742 (GRCm39) missense probably damaging 1.00
R9608:Sbf1 UTSW 15 89,191,808 (GRCm39) critical splice acceptor site probably null
R9673:Sbf1 UTSW 15 89,179,675 (GRCm39) missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GTACAGCCACTCACCTAAGG -3'
(R):5'- CATGAGCTACCTTCTGCTGC -3'

Sequencing Primer
(F):5'- TCACCTAAGGCATGCTCCC -3'
(R):5'- CCTCTGGACAGCAGCAAGAG -3'
Posted On 2014-08-25