Incidental Mutation 'R2025:Sbf1'
ID220522
Institutional Source Beutler Lab
Gene Symbol Sbf1
Ensembl Gene ENSMUSG00000036529
Gene NameSET binding factor 1
SynonymsB230113C15Rik, 2610510A08Rik, Mtmr5
MMRRC Submission 040034-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.382) question?
Stock #R2025 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location89288236-89315311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89302730 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 815 (E815V)
Ref Sequence ENSEMBL: ENSMUSP00000118107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123791] [ENSMUST00000124576] [ENSMUST00000144585] [ENSMUST00000146637]
PDB Structure
Solution Structure of the C-terminal Pleckstrin Homology Domain of Sbf1 from Mouse [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000123791
AA Change: E815V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120725
Gene: ENSMUSG00000036529
AA Change: E815V

DomainStartEndE-ValueType
uDENN 1 86 6.68e-31 SMART
DENN 128 310 4.05e-71 SMART
dDENN 363 432 1.28e-18 SMART
Pfam:SBF2 540 764 4.1e-110 PFAM
GRAM 882 968 3.93e-12 SMART
Pfam:Myotub-related 1100 1534 6.2e-114 PFAM
low complexity region 1614 1621 N/A INTRINSIC
low complexity region 1652 1666 N/A INTRINSIC
low complexity region 1719 1750 N/A INTRINSIC
PH 1762 1867 6.45e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124576
SMART Domains Protein: ENSMUSP00000115740
Gene: ENSMUSG00000036529

DomainStartEndE-ValueType
uDENN 1 86 6.68e-31 SMART
DENN 128 310 4.05e-71 SMART
Pfam:dDENN 363 403 4.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124642
SMART Domains Protein: ENSMUSP00000119943
Gene: ENSMUSG00000036529

DomainStartEndE-ValueType
Pfam:SBF2 1 94 1.2e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000144585
AA Change: E815V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118107
Gene: ENSMUSG00000036529
AA Change: E815V

DomainStartEndE-ValueType
uDENN 1 86 6.68e-31 SMART
DENN 128 310 4.05e-71 SMART
dDENN 363 432 1.28e-18 SMART
Pfam:SBF2 542 764 2.3e-108 PFAM
GRAM 882 968 3.93e-12 SMART
Pfam:Myotub-related 1106 1558 5.7e-93 PFAM
low complexity region 1640 1647 N/A INTRINSIC
low complexity region 1678 1692 N/A INTRINSIC
low complexity region 1745 1776 N/A INTRINSIC
PH 1788 1893 6.45e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146637
SMART Domains Protein: ENSMUSP00000122386
Gene: ENSMUSG00000036529

DomainStartEndE-ValueType
DENN 20 210 8.29e-68 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184827
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protein-tyrosine phosphatase family. However, the encoded protein does not appear to be a catalytically active phosphatase because it lacks several amino acids in the catalytic pocket. This protein contains a Guanine nucleotide exchange factor (GEF) domain which is necessary for its role in growth and differentiation. Mutations in this gene have been associated with Charcot-Marie-Tooth disease 4B3. Pseudogenes of this gene have been defined on chromosomes 1 and 8. [provided by RefSeq, Dec 2014]
PHENOTYPE: Male homozygotes for a targeted null mutation exhibit male infertility associated with azoospermia, vacuolation of Sertoli cells, reduced spermatid formation, and eventual depletion of germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik T C 2: 148,782,228 F41L probably damaging Het
Abcc4 T C 14: 118,553,325 M757V probably benign Het
Acan T G 7: 79,101,222 S1914A probably benign Het
Axin2 T A 11: 108,943,078 V617D probably damaging Het
Bhlhe22 A G 3: 18,055,811 S342G probably benign Het
Cald1 AAGAGAGAGAGAGAG AAGAGAGAGAGAG 6: 34,746,173 probably null Het
Ccdc34 A G 2: 110,032,386 K179E possibly damaging Het
Clasp1 A G 1: 118,504,899 T208A probably damaging Het
Crabp1 C T 9: 54,768,468 R112* probably null Het
D130040H23Rik A G 8: 69,302,873 N310S probably benign Het
Dalrd3 T C 9: 108,571,085 I278T probably benign Het
Dbp C A 7: 45,708,276 D89E probably benign Het
Dennd2c A G 3: 103,131,689 D51G possibly damaging Het
Dido1 A T 2: 180,689,181 L158* probably null Het
Disp1 G T 1: 183,088,203 F884L probably damaging Het
Dmrtb1 T C 4: 107,683,585 D193G probably damaging Het
Dnah8 A G 17: 30,731,159 D1984G probably damaging Het
Dpf2 T C 19: 5,902,753 Y218C possibly damaging Het
Dsg4 C T 18: 20,466,636 Q770* probably null Het
Efemp1 A T 11: 28,914,696 Y250F possibly damaging Het
Erbin A T 13: 103,830,195 I1249N probably benign Het
F5 A G 1: 164,209,475 K1928E probably benign Het
Fam160a2 A G 7: 105,388,936 V260A probably damaging Het
Fam206a T A 4: 56,805,916 I138N probably damaging Het
Gdf11 T A 10: 128,891,445 I81F probably damaging Het
Gm10518 T A 1: 179,803,918 probably benign Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Grb10 G C 11: 11,970,576 S14* probably null Het
Greb1l A T 18: 10,515,221 Y562F possibly damaging Het
Gtf2ird1 T C 5: 134,363,934 E789G probably damaging Het
Hook3 T C 8: 26,038,098 E588G probably damaging Het
Hpx A G 7: 105,595,104 S266P probably damaging Het
Hs6st3 A G 14: 119,869,389 D403G probably damaging Het
Igf2bp1 A G 11: 95,974,170 V151A possibly damaging Het
Itga11 C T 9: 62,762,811 T739I probably damaging Het
Kalrn T C 16: 34,189,736 I702V probably damaging Het
Kif2b C T 11: 91,577,346 S37N probably damaging Het
Kng2 T A 16: 23,000,575 D237V probably benign Het
Krtap27-1 C A 16: 88,671,285 V124L possibly damaging Het
Lig4 A T 8: 9,972,436 L448Q probably damaging Het
Macf1 C T 4: 123,371,918 A4821T probably damaging Het
Msh5 T A 17: 35,032,792 I431F possibly damaging Het
Ndufa10 A G 1: 92,439,892 Y339H probably damaging Het
Nin T A 12: 70,030,008 Q1091L probably damaging Het
Nom1 A C 5: 29,446,851 D729A probably damaging Het
Olfr671 C A 7: 104,975,244 G247V probably benign Het
P2ry14 A T 3: 59,115,445 V207E probably damaging Het
Pdss2 A T 10: 43,393,875 N238I possibly damaging Het
Pkn1 A G 8: 83,671,378 V795A probably damaging Het
Pla2g6 A C 15: 79,286,764 L804R probably damaging Het
Poglut1 A T 16: 38,537,905 probably null Het
Prkcz A T 4: 155,289,710 V83D probably damaging Het
Prss50 T C 9: 110,861,260 F157S probably benign Het
Psors1c2 A G 17: 35,534,202 probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rab7 G A 6: 88,004,179 L174F probably damaging Het
Rapgef4 A G 2: 72,242,739 T790A probably benign Het
Rb1cc1 G T 1: 6,245,309 V503L probably damaging Het
Setd3 T A 12: 108,160,267 E104V probably damaging Het
Slc39a5 A T 10: 128,398,410 L208Q probably damaging Het
Slc39a5 G T 10: 128,398,411 L208M probably damaging Het
Slc3a1 T G 17: 85,032,845 Y232D probably damaging Het
Slc8a1 T A 17: 81,649,112 S166C probably damaging Het
Stard9 T A 2: 120,702,398 D3045E probably benign Het
Stk4 C A 2: 164,096,831 D206E probably damaging Het
Syn3 T C 10: 86,466,982 D103G probably damaging Het
Tbc1d30 T A 10: 121,279,146 Y369F probably benign Het
Tenm2 G T 11: 36,047,264 Y1527* probably null Het
Tfg T C 16: 56,705,625 K85R possibly damaging Het
Timp3 T C 10: 86,300,885 L11P probably damaging Het
Tmem144 A T 3: 79,827,711 probably null Het
Tmtc4 T C 14: 122,921,265 N682S probably benign Het
Tnks2 C T 19: 36,866,066 L464F probably damaging Het
Trank1 T C 9: 111,392,039 F2615L probably benign Het
Trio T C 15: 27,744,137 K2570E probably damaging Het
Trio T A 15: 27,773,927 D673V probably damaging Het
Ublcp1 A T 11: 44,465,631 C87S probably benign Het
Unc13a C T 8: 71,639,768 E1386K possibly damaging Het
Wdr41 C T 13: 95,018,948 H404Y probably damaging Het
Zfp280b T C 10: 76,038,494 L69S probably damaging Het
Zfp346 T C 13: 55,132,308 S282P probably damaging Het
Zfp579 C A 7: 4,993,521 E464* probably null Het
Zfp78 T A 7: 6,375,514 probably null Het
Zswim9 T C 7: 13,269,366 E186G probably damaging Het
Other mutations in Sbf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00265:Sbf1 APN 15 89305575 missense probably damaging 0.98
IGL01478:Sbf1 APN 15 89299743 missense probably damaging 0.97
IGL01533:Sbf1 APN 15 89288716 missense probably damaging 0.99
IGL01603:Sbf1 APN 15 89303278 missense probably damaging 1.00
IGL01758:Sbf1 APN 15 89303215 unclassified probably benign
IGL01908:Sbf1 APN 15 89302726 missense probably damaging 1.00
IGL02067:Sbf1 APN 15 89289044 missense probably damaging 1.00
IGL02089:Sbf1 APN 15 89302505 nonsense probably null
IGL02150:Sbf1 APN 15 89295480 missense probably benign 0.00
IGL02284:Sbf1 APN 15 89305078 missense probably damaging 1.00
IGL02367:Sbf1 APN 15 89307572 missense probably damaging 0.99
IGL02427:Sbf1 APN 15 89305985 unclassified probably benign
IGL03025:Sbf1 APN 15 89289645 missense probably damaging 1.00
IGL03103:Sbf1 APN 15 89293947 missense probably damaging 1.00
IGL03226:Sbf1 APN 15 89289105 missense possibly damaging 0.93
IGL03376:Sbf1 APN 15 89289016 unclassified probably benign
IGL03397:Sbf1 APN 15 89288721 missense probably damaging 1.00
R0043:Sbf1 UTSW 15 89295561 missense probably benign 0.26
R0139:Sbf1 UTSW 15 89302498 missense probably damaging 1.00
R0528:Sbf1 UTSW 15 89288712 missense probably damaging 0.99
R0624:Sbf1 UTSW 15 89302329 missense possibly damaging 0.68
R0759:Sbf1 UTSW 15 89304716 missense probably damaging 1.00
R1555:Sbf1 UTSW 15 89305076 missense probably damaging 1.00
R1763:Sbf1 UTSW 15 89294425 missense probably damaging 1.00
R2207:Sbf1 UTSW 15 89306693 missense possibly damaging 0.88
R2844:Sbf1 UTSW 15 89303218 critical splice donor site probably null
R2845:Sbf1 UTSW 15 89303218 critical splice donor site probably null
R3788:Sbf1 UTSW 15 89299528 nonsense probably null
R4108:Sbf1 UTSW 15 89288585 unclassified probably benign
R4403:Sbf1 UTSW 15 89293954 missense possibly damaging 0.94
R4605:Sbf1 UTSW 15 89303481 missense probably damaging 1.00
R4620:Sbf1 UTSW 15 89306926 missense probably damaging 0.99
R4666:Sbf1 UTSW 15 89295246 missense probably damaging 1.00
R4696:Sbf1 UTSW 15 89303112 nonsense probably null
R4697:Sbf1 UTSW 15 89315085 missense possibly damaging 0.71
R4747:Sbf1 UTSW 15 89302713 missense probably damaging 1.00
R5828:Sbf1 UTSW 15 89288634 missense probably damaging 1.00
R5841:Sbf1 UTSW 15 89308068 missense probably damaging 1.00
R6185:Sbf1 UTSW 15 89305611 missense probably damaging 1.00
R6237:Sbf1 UTSW 15 89293476 missense probably benign 0.29
R6256:Sbf1 UTSW 15 89300867 missense probably benign 0.06
R6490:Sbf1 UTSW 15 89304908 missense probably benign
R6933:Sbf1 UTSW 15 89300369 missense probably damaging 1.00
R7806:Sbf1 UTSW 15 89305420 missense possibly damaging 0.52
R8005:Sbf1 UTSW 15 89294205 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTACAGCCACTCACCTAAGG -3'
(R):5'- CATGAGCTACCTTCTGCTGC -3'

Sequencing Primer
(F):5'- TCACCTAAGGCATGCTCCC -3'
(R):5'- CCTCTGGACAGCAGCAAGAG -3'
Posted On2014-08-25