Mutagenetix > Incidental Mutation

Incidental Mutation 'R2025:Kalrn'

220528

Institutional Source

Beutler Lab

Gene Symbol

Kalrn

Ensembl Gene

ENSMUSG00000061751

Gene Name

kalirin, RhoGEF kinase

Synonyms

2210407G14Rik, Hapip, E530005C20Rik, LOC224126

MMRRC Submission

040034-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.947) question?

Stock #

R2025 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

33969073-34573532 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 34189736 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 702 (I702V)

Ref Sequence

ENSEMBL: ENSMUSP00000110604 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076810] [ENSMUST00000089655] [ENSMUST00000114947] [ENSMUST00000114949] [ENSMUST00000114953] [ENSMUST00000114954] [ENSMUST00000114960] [ENSMUST00000114961] [ENSMUST00000151491]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000076810
AA Change: I1316V

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000076088
Gene: ENSMUSG00000061751
AA Change: I1316V

Domain	Start	End	E-Value	Type
SEC14	20	159	2.22e-30	SMART
SPEC	173	289	5.32e-9	SMART
SPEC	295	397	1.19e-11	SMART
SPEC	400	515	1.83e0	SMART
SPEC	521	623	9.84e-13	SMART
SPEC	626	748	2.74e-2	SMART
SPEC	875	976	8.11e-14	SMART
SPEC	1106	1208	4.7e-10	SMART
RhoGEF	1258	1428	3.6e-56	SMART
PH	1442	1555	5.24e-8	SMART
SH3	1622	1683	1.23e-7	SMART
RhoGEF	1904	2074	1.47e-52	SMART
PH	2094	2199	9.87e-4	SMART
SH3	2295	2356	2.78e-2	SMART
IGc2	2455	2527	4.28e-12	SMART
FN3	2541	2623	3.07e-11	SMART
S_TKc	2656	2910	1.28e-71	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000089655
AA Change: I1343V

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000087084
Gene: ENSMUSG00000061751
AA Change: I1343V

Domain	Start	End	E-Value	Type
low complexity region	9	20	N/A	INTRINSIC
SEC14	38	177	2.22e-30	SMART
SPEC	191	307	5.32e-9	SMART
SPEC	313	415	1.19e-11	SMART
SPEC	418	533	1.83e0	SMART
SPEC	539	641	9.84e-13	SMART
SPEC	644	766	2.74e-2	SMART
SPEC	893	1003	1.85e-8	SMART
SPEC	1133	1235	4.7e-10	SMART
RhoGEF	1285	1455	3.6e-56	SMART
PH	1469	1582	5.24e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114947
AA Change: I689V

PolyPhen 2 Score 0.319 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000110597
Gene: ENSMUSG00000061751
AA Change: I689V

Domain	Start	End	E-Value	Type
SPEC	3	112	4.22e-3	SMART
internal_repeat_1	128	187	9.63e-6	PROSPERO
SPEC	239	349	1.85e-8	SMART
SPEC	479	581	4.7e-10	SMART
RhoGEF	631	801	3.6e-56	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114949
AA Change: I693V

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000110599
Gene: ENSMUSG00000061751
AA Change: I693V

Domain	Start	End	E-Value	Type
SPEC	3	125	2.74e-2	SMART
internal_repeat_1	141	204	2.9e-5	PROSPERO
SPEC	252	353	8.11e-14	SMART
SPEC	483	585	4.7e-10	SMART
RhoGEF	635	805	3.6e-56	SMART
PH	819	932	5.24e-8	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000114953
AA Change: I702V

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000110603
Gene: ENSMUSG00000061751
AA Change: I702V

Domain	Start	End	E-Value	Type
SPEC	3	125	2.74e-2	SMART
internal_repeat_1	141	204	4.18e-5	PROSPERO
coiled coil region	217	248	N/A	INTRINSIC
SPEC	252	362	1.85e-8	SMART
SPEC	492	594	4.7e-10	SMART
RhoGEF	644	814	3.6e-56	SMART
PH	828	941	5.24e-8	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000114954
AA Change: I702V

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000110604
Gene: ENSMUSG00000061751
AA Change: I702V

Domain	Start	End	E-Value	Type
SPEC	3	125	2.74e-2	SMART
internal_repeat_1	141	204	4.18e-5	PROSPERO
coiled coil region	217	248	N/A	INTRINSIC
SPEC	252	362	1.85e-8	SMART
SPEC	492	594	4.7e-10	SMART
RhoGEF	644	814	3.6e-56	SMART
PH	828	941	5.24e-8	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114960
AA Change: I1334V

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000110611
Gene: ENSMUSG00000061751
AA Change: I1334V

Domain	Start	End	E-Value	Type
low complexity region	9	20	N/A	INTRINSIC
SEC14	38	177	2.22e-30	SMART
SPEC	191	307	5.32e-9	SMART
SPEC	313	415	1.19e-11	SMART
SPEC	418	533	1.83e0	SMART
SPEC	539	641	9.84e-13	SMART
SPEC	644	766	2.74e-2	SMART
SPEC	893	994	8.11e-14	SMART
SPEC	1124	1226	4.7e-10	SMART
RhoGEF	1276	1446	3.6e-56	SMART
PH	1460	1573	5.24e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000114961

SMART Domains

Protein: ENSMUSP00000110612
Gene: ENSMUSG00000061751

Domain	Start	End	E-Value	Type
SEC14	40	179	2.22e-30	SMART
SPEC	193	309	5.32e-9	SMART
SPEC	315	417	1.19e-11	SMART
SPEC	420	535	1.83e0	SMART
SPEC	541	643	9.84e-13	SMART
SPEC	646	768	2.74e-2	SMART
SPEC	895	996	8.11e-14	SMART
SPEC	1126	1228	4.7e-10	SMART
RhoGEF	1278	1448	3.6e-56	SMART
PH	1462	1575	5.24e-8	SMART
SH3	1642	1703	1.23e-7	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000142817
AA Change: I1311V

SMART Domains

Protein: ENSMUSP00000116188
Gene: ENSMUSG00000061751
AA Change: I1311V

Domain	Start	End	E-Value	Type
SEC14	16	155	2.22e-30	SMART
SPEC	169	285	5.32e-9	SMART
SPEC	291	393	1.19e-11	SMART
SPEC	396	511	1.83e0	SMART
SPEC	517	619	9.84e-13	SMART
SPEC	622	744	2.74e-2	SMART
SPEC	871	972	8.11e-14	SMART
SPEC	1102	1204	4.7e-10	SMART
RhoGEF	1254	1424	3.6e-56	SMART
PH	1438	1551	5.24e-8	SMART
SH3	1618	1679	1.23e-7	SMART
RhoGEF	1900	2070	1.47e-52	SMART
PH	2090	2195	9.87e-4	SMART
SH3	2291	2352	2.78e-2	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000151491
AA Change: I1090V

PolyPhen 2 Score 0.713 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000123416
Gene: ENSMUSG00000061751
AA Change: I1090V

Domain	Start	End	E-Value	Type
SEC14	26	165	2.22e-30	SMART
SPEC	179	295	5.32e-9	SMART
SPEC	301	403	1.19e-11	SMART
SPEC	640	750	1.85e-8	SMART
SPEC	880	982	4.7e-10	SMART
RhoGEF	1032	1202	3.6e-56	SMART
PH	1216	1329	5.24e-8	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein that interacts with the huntingtin-associated protein 1, which is a huntingtin binding protein that may function in vesicle trafficking. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele specific for isoform 7 exhibit decreased anxiety-related behavior, contextual conditioning, and synapse formation. Mice homozygous for another knock-out allele exhibit impaired AMPA-mediated synaptic currents and abnormal behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8030411F24Rik	T	C	2: 148,782,228	F41L	probably damaging	Het
Abcc4	T	C	14: 118,553,325	M757V	probably benign	Het
Acan	T	G	7: 79,101,222	S1914A	probably benign	Het
Axin2	T	A	11: 108,943,078	V617D	probably damaging	Het
Bhlhe22	A	G	3: 18,055,811	S342G	probably benign	Het
Cald1	AAGAGAGAGAGAGAG	AAGAGAGAGAGAG	6: 34,746,173		probably null	Het
Ccdc34	A	G	2: 110,032,386	K179E	possibly damaging	Het
Clasp1	A	G	1: 118,504,899	T208A	probably damaging	Het
Crabp1	C	T	9: 54,768,468	R112*	probably null	Het
D130040H23Rik	A	G	8: 69,302,873	N310S	probably benign	Het
Dalrd3	T	C	9: 108,571,085	I278T	probably benign	Het
Dbp	C	A	7: 45,708,276	D89E	probably benign	Het
Dennd2c	A	G	3: 103,131,689	D51G	possibly damaging	Het
Dido1	A	T	2: 180,689,181	L158*	probably null	Het
Disp1	G	T	1: 183,088,203	F884L	probably damaging	Het
Dmrtb1	T	C	4: 107,683,585	D193G	probably damaging	Het
Dnah8	A	G	17: 30,731,159	D1984G	probably damaging	Het
Dpf2	T	C	19: 5,902,753	Y218C	possibly damaging	Het
Dsg4	C	T	18: 20,466,636	Q770*	probably null	Het
Efemp1	A	T	11: 28,914,696	Y250F	possibly damaging	Het
Erbin	A	T	13: 103,830,195	I1249N	probably benign	Het
F5	A	G	1: 164,209,475	K1928E	probably benign	Het
Fam160a2	A	G	7: 105,388,936	V260A	probably damaging	Het
Fam206a	T	A	4: 56,805,916	I138N	probably damaging	Het
Gdf11	T	A	10: 128,891,445	I81F	probably damaging	Het
Gm10518	T	A	1: 179,803,918		probably benign	Het
Gm14685	G	T	X: 73,127,655	G218C	probably damaging	Het
Grb10	G	C	11: 11,970,576	S14*	probably null	Het
Greb1l	A	T	18: 10,515,221	Y562F	possibly damaging	Het
Gtf2ird1	T	C	5: 134,363,934	E789G	probably damaging	Het
Hook3	T	C	8: 26,038,098	E588G	probably damaging	Het
Hpx	A	G	7: 105,595,104	S266P	probably damaging	Het
Hs6st3	A	G	14: 119,869,389	D403G	probably damaging	Het
Igf2bp1	A	G	11: 95,974,170	V151A	possibly damaging	Het
Itga11	C	T	9: 62,762,811	T739I	probably damaging	Het
Kif2b	C	T	11: 91,577,346	S37N	probably damaging	Het
Kng2	T	A	16: 23,000,575	D237V	probably benign	Het
Krtap27-1	C	A	16: 88,671,285	V124L	possibly damaging	Het
Lig4	A	T	8: 9,972,436	L448Q	probably damaging	Het
Macf1	C	T	4: 123,371,918	A4821T	probably damaging	Het
Msh5	T	A	17: 35,032,792	I431F	possibly damaging	Het
Ndufa10	A	G	1: 92,439,892	Y339H	probably damaging	Het
Nin	T	A	12: 70,030,008	Q1091L	probably damaging	Het
Nom1	A	C	5: 29,446,851	D729A	probably damaging	Het
Olfr671	C	A	7: 104,975,244	G247V	probably benign	Het
P2ry14	A	T	3: 59,115,445	V207E	probably damaging	Het
Pdss2	A	T	10: 43,393,875	N238I	possibly damaging	Het
Pkn1	A	G	8: 83,671,378	V795A	probably damaging	Het
Pla2g6	A	C	15: 79,286,764	L804R	probably damaging	Het
Poglut1	A	T	16: 38,537,905		probably null	Het
Prkcz	A	T	4: 155,289,710	V83D	probably damaging	Het
Prss50	T	C	9: 110,861,260	F157S	probably benign	Het
Psors1c2	A	G	17: 35,534,202		probably benign	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rab7	G	A	6: 88,004,179	L174F	probably damaging	Het
Rapgef4	A	G	2: 72,242,739	T790A	probably benign	Het
Rb1cc1	G	T	1: 6,245,309	V503L	probably damaging	Het
Sbf1	T	A	15: 89,302,730	E815V	probably damaging	Het
Setd3	T	A	12: 108,160,267	E104V	probably damaging	Het
Slc39a5	A	T	10: 128,398,410	L208Q	probably damaging	Het
Slc39a5	G	T	10: 128,398,411	L208M	probably damaging	Het
Slc3a1	T	G	17: 85,032,845	Y232D	probably damaging	Het
Slc8a1	T	A	17: 81,649,112	S166C	probably damaging	Het
Stard9	T	A	2: 120,702,398	D3045E	probably benign	Het
Stk4	C	A	2: 164,096,831	D206E	probably damaging	Het
Syn3	T	C	10: 86,466,982	D103G	probably damaging	Het
Tbc1d30	T	A	10: 121,279,146	Y369F	probably benign	Het
Tenm2	G	T	11: 36,047,264	Y1527*	probably null	Het
Tfg	T	C	16: 56,705,625	K85R	possibly damaging	Het
Timp3	T	C	10: 86,300,885	L11P	probably damaging	Het
Tmem144	A	T	3: 79,827,711		probably null	Het
Tmtc4	T	C	14: 122,921,265	N682S	probably benign	Het
Tnks2	C	T	19: 36,866,066	L464F	probably damaging	Het
Trank1	T	C	9: 111,392,039	F2615L	probably benign	Het
Trio	T	C	15: 27,744,137	K2570E	probably damaging	Het
Trio	T	A	15: 27,773,927	D673V	probably damaging	Het
Ublcp1	A	T	11: 44,465,631	C87S	probably benign	Het
Unc13a	C	T	8: 71,639,768	E1386K	possibly damaging	Het
Wdr41	C	T	13: 95,018,948	H404Y	probably damaging	Het
Zfp280b	T	C	10: 76,038,494	L69S	probably damaging	Het
Zfp346	T	C	13: 55,132,308	S282P	probably damaging	Het
Zfp579	C	A	7: 4,993,521	E464*	probably null	Het
Zfp78	T	A	7: 6,375,514		probably null	Het
Zswim9	T	C	7: 13,269,366	E186G	probably damaging	Het

Other mutations in Kalrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01361:Kalrn	APN	16	34175722	splice site	probably benign
IGL01364:Kalrn	APN	16	34262629	missense	probably damaging	1.00
IGL01510:Kalrn	APN	16	34235330	missense	possibly damaging	0.52
IGL01664:Kalrn	APN	16	34294161	missense	probably damaging	1.00
IGL01934:Kalrn	APN	16	34198512	splice site	probably null
IGL02059:Kalrn	APN	16	34252341	missense	possibly damaging	0.95
IGL02102:Kalrn	APN	16	34220222	missense	probably damaging	1.00
IGL02306:Kalrn	APN	16	34310527	missense	probably damaging	0.97
IGL02328:Kalrn	APN	16	34332224	missense	probably damaging	0.98
IGL02532:Kalrn	APN	16	34360846	missense	probably damaging	1.00
IGL02685:Kalrn	APN	16	34513959	nonsense	probably null
IGL02696:Kalrn	APN	16	34220114	missense	probably damaging	1.00
IGL02708:Kalrn	APN	16	34392050	missense	probably damaging	1.00
IGL02937:Kalrn	APN	16	34220130	nonsense	probably null
IGL03188:Kalrn	APN	16	34314192	missense	probably benign	0.01
IGL03289:Kalrn	APN	16	34385297	missense	possibly damaging	0.90
IGL03408:Kalrn	APN	16	34314176	missense	probably damaging	0.99
breeze	UTSW	16	34013675	missense
ethereal	UTSW	16	33975435	utr 3 prime	probably benign
Feather	UTSW	16	34314209	missense	probably damaging	0.99
Hidden	UTSW	16	34027976	missense	probably damaging	1.00
Soulful	UTSW	16	34187484	nonsense	probably null
G1Funyon:Kalrn	UTSW	16	34357100	missense	probably benign	0.05
PIT4498001:Kalrn	UTSW	16	34031582	missense	possibly damaging	0.81
R0019:Kalrn	UTSW	16	34198514	splice site	probably benign
R0043:Kalrn	UTSW	16	34054906	missense	probably damaging	1.00
R0052:Kalrn	UTSW	16	34357171	missense	probably damaging	1.00
R0066:Kalrn	UTSW	16	34203957	missense	probably damaging	1.00
R0098:Kalrn	UTSW	16	33975619	missense	possibly damaging	0.89
R0098:Kalrn	UTSW	16	33975619	missense	possibly damaging	0.89
R0111:Kalrn	UTSW	16	34031590	missense	probably damaging	1.00
R0113:Kalrn	UTSW	16	34049936	intron	probably benign
R0183:Kalrn	UTSW	16	34171379	splice site	probably null
R0422:Kalrn	UTSW	16	34314273	missense	probably damaging	0.99
R0498:Kalrn	UTSW	16	34054891	missense	possibly damaging	0.61
R0614:Kalrn	UTSW	16	33993670	splice site	probably benign
R0656:Kalrn	UTSW	16	34032467	missense	probably damaging	1.00
R0671:Kalrn	UTSW	16	34116408	missense	probably benign	0.04
R0707:Kalrn	UTSW	16	34010581	missense	possibly damaging	0.88
R0709:Kalrn	UTSW	16	34035554	missense	probably damaging	1.00
R0834:Kalrn	UTSW	16	34049919	missense	possibly damaging	0.94
R0976:Kalrn	UTSW	16	34385390	missense	probably damaging	1.00
R1297:Kalrn	UTSW	16	34016498	missense	probably damaging	0.99
R1355:Kalrn	UTSW	16	33975584	missense	possibly damaging	0.74
R1370:Kalrn	UTSW	16	33975584	missense	possibly damaging	0.74
R1389:Kalrn	UTSW	16	33988803	missense	probably benign	0.01
R1398:Kalrn	UTSW	16	34212820	missense	probably damaging	1.00
R1427:Kalrn	UTSW	16	33975754	missense	probably damaging	1.00
R1458:Kalrn	UTSW	16	34174487	missense	probably damaging	1.00
R1470:Kalrn	UTSW	16	34187471	missense	probably damaging	1.00
R1470:Kalrn	UTSW	16	34187471	missense	probably damaging	1.00
R1557:Kalrn	UTSW	16	34314278	missense	possibly damaging	0.92
R1559:Kalrn	UTSW	16	34010548	missense	possibly damaging	0.92
R1654:Kalrn	UTSW	16	33975738	missense	probably damaging	1.00
R1703:Kalrn	UTSW	16	34205326	missense	probably damaging	1.00
R1759:Kalrn	UTSW	16	34360950	missense	probably damaging	0.97
R1764:Kalrn	UTSW	16	34212873	missense	probably damaging	1.00
R1824:Kalrn	UTSW	16	34294215	missense	probably damaging	1.00
R1845:Kalrn	UTSW	16	34356961	missense	probably damaging	0.99
R1850:Kalrn	UTSW	16	33975923	missense	probably damaging	0.98
R1921:Kalrn	UTSW	16	34392093	missense	probably benign	0.02
R1922:Kalrn	UTSW	16	34392093	missense	probably benign	0.02
R1970:Kalrn	UTSW	16	33977524	critical splice donor site	probably null
R1991:Kalrn	UTSW	16	33975738	missense	probably damaging	1.00
R1992:Kalrn	UTSW	16	33975738	missense	probably damaging	1.00
R2001:Kalrn	UTSW	16	34028045	missense	probably damaging	1.00
R2048:Kalrn	UTSW	16	34252310	missense	probably benign	0.18
R2076:Kalrn	UTSW	16	34332143	missense	probably benign	0.15
R2118:Kalrn	UTSW	16	34332230	missense	possibly damaging	0.84
R2136:Kalrn	UTSW	16	34307724	missense	possibly damaging	0.82
R2145:Kalrn	UTSW	16	34009262	unclassified	probably benign
R2193:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R2195:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R2234:Kalrn	UTSW	16	34176262	splice site	probably null
R2404:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R2405:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R2408:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R2411:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R2570:Kalrn	UTSW	16	34310495	missense	probably damaging	1.00
R2903:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R2904:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R2924:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R3411:Kalrn	UTSW	16	34212272	missense	probably benign	0.07
R3693:Kalrn	UTSW	16	34357315	missense	probably damaging	1.00
R3709:Kalrn	UTSW	16	34392030	splice site	probably null
R3788:Kalrn	UTSW	16	34220240	missense	probably damaging	1.00
R3833:Kalrn	UTSW	16	34039889	nonsense	probably null
R3871:Kalrn	UTSW	16	34203856	splice site	probably null
R3934:Kalrn	UTSW	16	34310531	missense	probably benign	0.34
R4033:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R4056:Kalrn	UTSW	16	34314209	missense	probably damaging	0.99
R4057:Kalrn	UTSW	16	34314209	missense	probably damaging	0.99
R4303:Kalrn	UTSW	16	34235391	missense	probably damaging	1.00
R4402:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R4444:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R4482:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R4487:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R4558:Kalrn	UTSW	16	33987208	missense	possibly damaging	0.46
R4572:Kalrn	UTSW	16	34392042	missense	probably damaging	0.98
R4583:Kalrn	UTSW	16	34235267	missense	probably damaging	1.00
R4604:Kalrn	UTSW	16	34513926	missense	possibly damaging	0.46
R4620:Kalrn	UTSW	16	34028705	missense	probably damaging	0.99
R4651:Kalrn	UTSW	16	34176391	missense	probably damaging	1.00
R4703:Kalrn	UTSW	16	34203957	missense	probably damaging	1.00
R4704:Kalrn	UTSW	16	34203957	missense	probably damaging	1.00
R4705:Kalrn	UTSW	16	34203957	missense	probably damaging	1.00
R4760:Kalrn	UTSW	16	34198487	missense	probably damaging	1.00
R4793:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R4794:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R4811:Kalrn	UTSW	16	34356969	missense	probably damaging	1.00
R4816:Kalrn	UTSW	16	34514019	unclassified	probably benign
R4888:Kalrn	UTSW	16	34171330	missense	probably damaging	1.00
R4952:Kalrn	UTSW	16	34357415	splice site	probably null
R5030:Kalrn	UTSW	16	33975742	missense	probably benign	0.00
R5045:Kalrn	UTSW	16	34314352	nonsense	probably null
R5117:Kalrn	UTSW	16	34033601	critical splice acceptor site	probably null
R5289:Kalrn	UTSW	16	34252341	missense	possibly damaging	0.95
R5426:Kalrn	UTSW	16	34262653	missense	probably damaging	1.00
R5432:Kalrn	UTSW	16	34053622	missense	probably damaging	1.00
R5611:Kalrn	UTSW	16	34175780	missense	probably damaging	1.00
R5629:Kalrn	UTSW	16	34039934	missense	possibly damaging	0.77
R5635:Kalrn	UTSW	16	34014084	missense	probably damaging	1.00
R5713:Kalrn	UTSW	16	34016579	missense	probably benign
R5716:Kalrn	UTSW	16	33987176	missense	probably benign	0.01
R5772:Kalrn	UTSW	16	33975820	missense	probably damaging	1.00
R5797:Kalrn	UTSW	16	34212249	missense	probably damaging	0.98
R5835:Kalrn	UTSW	16	33987091	missense	probably benign	0.28
R5895:Kalrn	UTSW	16	33975435	utr 3 prime	probably benign
R5924:Kalrn	UTSW	16	34243833	missense	probably damaging	1.00
R5999:Kalrn	UTSW	16	34357343	missense	probably damaging	1.00
R6010:Kalrn	UTSW	16	34010580	missense	probably benign	0.06
R6052:Kalrn	UTSW	16	34360885	missense	probably damaging	1.00
R6122:Kalrn	UTSW	16	33985191	missense	possibly damaging	0.82
R6128:Kalrn	UTSW	16	34212885	missense	probably damaging	0.99
R6136:Kalrn	UTSW	16	34357111	missense	probably damaging	1.00
R6178:Kalrn	UTSW	16	34053639	missense	possibly damaging	0.88
R6229:Kalrn	UTSW	16	34055071	missense	probably damaging	1.00
R6376:Kalrn	UTSW	16	33975991	missense	probably benign
R6397:Kalrn	UTSW	16	33992985	missense	probably damaging	1.00
R6429:Kalrn	UTSW	16	34332164	missense	possibly damaging	0.85
R6473:Kalrn	UTSW	16	34205302	missense	probably damaging	1.00
R6481:Kalrn	UTSW	16	34360984	missense	probably damaging	1.00
R6597:Kalrn	UTSW	16	34182747	missense	probably damaging	1.00
R6736:Kalrn	UTSW	16	34217923	missense	probably damaging	1.00
R6808:Kalrn	UTSW	16	34027976	missense	probably damaging	1.00
R6897:Kalrn	UTSW	16	33975703	missense	probably damaging	0.99
R6955:Kalrn	UTSW	16	34220136	missense	probably damaging	1.00
R7060:Kalrn	UTSW	16	34357048	missense	probably damaging	0.99
R7064:Kalrn	UTSW	16	34217891	missense	probably damaging	1.00
R7132:Kalrn	UTSW	16	34256227	missense	unknown
R7154:Kalrn	UTSW	16	34212157	critical splice donor site	probably null
R7181:Kalrn	UTSW	16	34163077	missense	probably benign	0.00
R7234:Kalrn	UTSW	16	34176422	missense	possibly damaging	0.63
R7235:Kalrn	UTSW	16	34175761	missense	probably benign	0.18
R7504:Kalrn	UTSW	16	34256233	missense	unknown
R7563:Kalrn	UTSW	16	34392094	missense	probably damaging	0.97
R7612:Kalrn	UTSW	16	34314212	missense	possibly damaging	0.68
R7772:Kalrn	UTSW	16	34031582	missense	probably benign	0.04
R7796:Kalrn	UTSW	16	34187484	nonsense	probably null
R7867:Kalrn	UTSW	16	33989791	missense	possibly damaging	0.94
R7869:Kalrn	UTSW	16	33988847	missense	probably damaging	0.98
R7914:Kalrn	UTSW	16	34028752	missense	probably benign
R8080:Kalrn	UTSW	16	33975668	missense	possibly damaging	0.83
R8147:Kalrn	UTSW	16	34055044	missense	probably benign
R8239:Kalrn	UTSW	16	34049783	missense	noncoding transcript
R8281:Kalrn	UTSW	16	34035061	nonsense	probably null
R8294:Kalrn	UTSW	16	34033584	missense	probably benign	0.12
R8301:Kalrn	UTSW	16	34357100	missense	probably benign	0.05
R8686:Kalrn	UTSW	16	34360935	missense	probably damaging	1.00
R8693:Kalrn	UTSW	16	34034514	missense	probably damaging	1.00
R8798:Kalrn	UTSW	16	33982855	missense	possibly damaging	0.65
R8878:Kalrn	UTSW	16	34198460	missense	probably benign	0.05
R8878:Kalrn	UTSW	16	34205326	missense	probably damaging	1.00
R8880:Kalrn	UTSW	16	34217935	missense	probably damaging	1.00
R8883:Kalrn	UTSW	16	33993655	missense	probably damaging	1.00
R8887:Kalrn	UTSW	16	34227126	missense	probably benign	0.22
R9048:Kalrn	UTSW	16	34034484	missense	possibly damaging	0.84
R9111:Kalrn	UTSW	16	34361001	missense	probably damaging	0.96
R9317:Kalrn	UTSW	16	34013675	missense
R9424:Kalrn	UTSW	16	33988818	missense	probably benign	0.06
R9442:Kalrn	UTSW	16	34095879	start codon destroyed	probably null	0.56
R9445:Kalrn	UTSW	16	33985230	missense	probably benign	0.13
R9515:Kalrn	UTSW	16	34034494	missense	probably damaging	1.00
R9516:Kalrn	UTSW	16	34034494	missense	probably damaging	1.00
R9625:Kalrn	UTSW	16	34028827	critical splice acceptor site	probably null
R9645:Kalrn	UTSW	16	34212213	missense	probably benign	0.01
RF014:Kalrn	UTSW	16	34039933	missense	probably benign	0.01
Z1177:Kalrn	UTSW	16	34035506	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCTACTCGTGATACCTCTGCAG -3'
(R):5'- GGAGGGGCTATTTTAAGTAGCACTG -3'

Sequencing Primer
(F):5'- GTGATACCTCTGCAGCACCTG -3'
(R):5'- GCACTGGTTAGTCAATTACTGTAC -3'

Posted On

2014-08-25