Mutagenetix > Incidental Mutation

Incidental Mutation 'R1985:Ptch1'

220533

Institutional Source

Beutler Lab

Gene Symbol

Ptch1

Ensembl Gene

ENSMUSG00000021466

Gene Name

patched 1

Synonyms

A230106A15Rik, Patched 1, Ptc1, Ptc

MMRRC Submission

039997-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1985 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

63508328-63573598 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 63524959 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Alanine at position 944 (E944A)

Ref Sequence

ENSEMBL: ENSMUSP00000021921 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021921] [ENSMUST00000192155] [ENSMUST00000194663] [ENSMUST00000195258]

AlphaFold

Q61115

Predicted Effect

probably benign
Transcript: ENSMUST00000021921
AA Change: E944A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000021921
Gene: ENSMUSG00000021466
AA Change: E944A

Domain	Start	End	E-Value	Type
low complexity region	4	30	N/A	INTRINSIC
Pfam:Patched	351	871	7.6e-47	PFAM
Pfam:Sterol-sensing	448	602	1.5e-45	PFAM
Pfam:Patched	952	1166	9.8e-33	PFAM
low complexity region	1180	1189	N/A	INTRINSIC
low complexity region	1204	1213	N/A	INTRINSIC
low complexity region	1281	1296	N/A	INTRINSIC
low complexity region	1355	1367	N/A	INTRINSIC
low complexity region	1369	1384	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000192155
AA Change: E807A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000141489
Gene: ENSMUSG00000021466
AA Change: E807A

Domain	Start	End	E-Value	Type
Pfam:Patched	214	733	3.1e-44	PFAM
Pfam:Sterol-sensing	311	465	2.8e-46	PFAM
Pfam:Patched	814	1029	3.1e-30	PFAM
low complexity region	1043	1052	N/A	INTRINSIC
low complexity region	1067	1076	N/A	INTRINSIC
low complexity region	1144	1159	N/A	INTRINSIC
low complexity region	1218	1230	N/A	INTRINSIC
low complexity region	1232	1247	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000194663

SMART Domains

Protein: ENSMUSP00000141766
Gene: ENSMUSG00000021466

Domain	Start	End	E-Value	Type
Pfam:Patched	298	569	4.7e-34	PFAM
Pfam:Sterol-sensing	396	550	7.9e-47	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000195258

SMART Domains

Protein: ENSMUSP00000141309
Gene: ENSMUSG00000021466

Domain	Start	End	E-Value	Type
Pfam:Patched	212	426	7.8e-28	PFAM
Pfam:Sterol-sensing	311	426	8e-33	PFAM

Meta Mutation Damage Score

0.1368

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 94.2%

Validation Efficiency

94% (76/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the patched gene family. The encoded protein is the receptor for sonic hedgehog, a secreted molecule implicated in the formation of embryonic structures and in tumorigenesis, as well as the desert hedgehog and indian hedgehog proteins. This gene functions as a tumor suppressor. Mutations of this gene have been associated with basal cell nevus syndrome, esophageal squamous cell carcinoma, trichoepitheliomas, transitional cell carcinomas of the bladder, as well as holoprosencephaly. Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences and biological validity cannot be determined currently. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die by day 10 with neural tube defects. Heterozygotes are large with excess cerebellar granule cell proliferation and sometimes, hindlimb defects and medulloblastomas. Hypomorphic and spontaneous mutants have reproductive defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1190007I07Rik	T	A	10: 82,620,217	T37S	possibly damaging	Het
AA792892	A	T	5: 94,384,072	I272L	probably benign	Het
Abhd8	C	A	8: 71,463,513		probably benign	Het
Adam5	A	T	8: 24,746,739	D648E	probably benign	Het
Akr1d1	A	G	6: 37,558,401	D240G	probably damaging	Het
Ankmy2	A	G	12: 36,157,364	H3R	possibly damaging	Het
Anpep	A	C	7: 79,840,857		probably null	Het
Apobr	A	G	7: 126,587,731	T20A	possibly damaging	Het
Atp2a2	A	T	5: 122,466,836	Y427N	probably benign	Het
Camkk2	A	C	5: 122,764,127	S40A	possibly damaging	Het
Camp	T	C	9: 109,848,429	N112S	probably benign	Het
Cbx7	A	G	15: 79,918,390	S229P	probably damaging	Het
Cnot2	T	C	10: 116,527,876	N41S	probably damaging	Het
Dchs1	A	G	7: 105,772,398	F272L	possibly damaging	Het
Dct	T	C	14: 118,036,542	K318E	probably benign	Het
Dhrs11	A	C	11: 84,828,807	L31V	probably damaging	Het
Dnah7a	T	C	1: 53,503,934	D2359G	probably benign	Het
Dnajc7	A	G	11: 100,590,892	S305P	probably benign	Het
Dscc1	CTGAATGAAT	CTGAAT	15: 55,080,176		probably benign	Het
Fam71b	T	C	11: 46,407,866	*666Q	probably null	Het
Flnc	A	G	6: 29,444,416		probably benign	Het
Gm7535	A	G	17: 17,911,538		probably benign	Het
Grtp1	A	G	8: 13,179,376	F313L	probably damaging	Het
Haus6	T	C	4: 86,593,609	Y425C	possibly damaging	Het
Hdac1	T	A	4: 129,528,960	N83Y	possibly damaging	Het
Hdlbp	A	G	1: 93,431,118	I237T	probably damaging	Het
Hfm1	A	T	5: 106,898,576	D481E	probably damaging	Het
Hipk3	T	C	2: 104,434,435	I737V	probably benign	Het
Il23r	T	A	6: 67,490,668		probably null	Het
Il24	G	A	1: 130,882,531	T196I	probably benign	Het
Ints3	C	T	3: 90,400,303		probably null	Het
Kcna6	T	C	6: 126,738,510	E472G	probably benign	Het
Kcnj16	C	T	11: 111,025,583	T357M	probably benign	Het
Kdm4b	T	A	17: 56,401,302	V957E	probably damaging	Het
Kif21b	G	A	1: 136,147,546	D166N	probably damaging	Het
Klhl11	G	T	11: 100,463,244	Q584K	probably benign	Het
Krt9	A	T	11: 100,189,991	M345K	probably benign	Het
Lgr5	T	C	10: 115,495,245		probably benign	Het
Lilr4b	A	T	10: 51,481,735	Q80L	possibly damaging	Het
Lrrc69	T	C	4: 14,708,669	E225G	possibly damaging	Het
Ly9	A	G	1: 171,599,773	S405P	probably damaging	Het
Myh2	A	G	11: 67,180,914	D519G	possibly damaging	Het
Nav3	G	A	10: 109,770,184		probably benign	Het
Nfkb1	G	A	3: 135,615,349	T215I	possibly damaging	Het
Ninj2	A	T	6: 120,198,639		probably benign	Het
Obsl1	A	G	1: 75,505,600	C209R	probably damaging	Het
Olfr1393	T	C	11: 49,280,283	I45T	probably damaging	Het
Olfr314	A	C	11: 58,786,384	D50A	probably damaging	Het
Olfr531	A	T	7: 140,400,800	M82K	possibly damaging	Het
Olfr539	G	A	7: 140,667,821	C171Y	probably damaging	Het
Olfr619	A	T	7: 103,603,672	Y6F	probably benign	Het
Olfr710	A	G	7: 106,944,926	I25T	probably benign	Het
Otud4	G	C	8: 79,640,012	R36P	probably damaging	Het
Pcnt	C	T	10: 76,380,337	R2239H	possibly damaging	Het
Pgbd5	T	A	8: 124,370,592	M491L	probably benign	Het
Pitrm1	A	T	13: 6,558,184	D316V	probably damaging	Het
Plod3	A	G	5: 136,990,853		probably null	Het
Plppr3	A	T	10: 79,867,460	Y63*	probably null	Het
Prickle2	T	C	6: 92,411,452	D323G	probably damaging	Het
Psmd11	A	T	11: 80,445,263	I114F	probably damaging	Het
Rbp3	C	T	14: 33,956,018	T641M	probably damaging	Het
Rbp3	T	G	14: 33,956,461	S789A	probably benign	Het
Rfxap	C	A	3: 54,807,326	R117L	probably damaging	Het
Rims2	T	A	15: 39,345,314	M171K	probably damaging	Het
Scin	A	G	12: 40,133,908		probably null	Het
Scn11a	A	G	9: 119,754,678	S1624P	probably benign	Het
Slc41a3	G	A	6: 90,642,228	V330M	probably damaging	Het
Slc9c1	A	G	16: 45,550,106	I237V	probably benign	Het
Spag6	A	G	2: 18,732,119	I218V	probably benign	Het
Stam2	T	C	2: 52,709,626	T257A	possibly damaging	Het
Tbc1d24	G	A	17: 24,207,964	R318*	probably null	Het
Tedc2	T	A	17: 24,216,317	E366V	probably damaging	Het
Tedc2	C	A	17: 24,216,318	E366*	probably null	Het
Trpm3	T	A	19: 22,926,082	Y1069N	possibly damaging	Het
Tuba8	A	G	6: 121,220,520	D47G	probably benign	Het
Tulp3	A	T	6: 128,326,806	S277T	probably benign	Het
Wdr7	GTT	GT	18: 63,760,583		probably null	Het
Ybx2	A	G	11: 69,936,468		probably null	Het
Zfp407	C	T	18: 84,559,773	A1072T	probably benign	Het
Zfp788	T	A	7: 41,650,481	I795N	probably damaging	Het

Other mutations in Ptch1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00567:Ptch1	APN	13	63527175	missense	probably benign	0.00
IGL01084:Ptch1	APN	13	63543637	missense	probably damaging	0.99
IGL01369:Ptch1	APN	13	63511681	missense	probably benign
IGL02260:Ptch1	APN	13	63565352	unclassified	probably benign
IGL02439:Ptch1	APN	13	63545096	missense	probably damaging	1.00
IGL02588:Ptch1	APN	13	63511918	missense	probably benign	0.13
IGL02797:Ptch1	APN	13	63533607	missense	probably benign
R0463:Ptch1	UTSW	13	63520307	missense	probably damaging	0.98
R0539:Ptch1	UTSW	13	63543480	splice site	probably benign
R0657:Ptch1	UTSW	13	63513751	missense	possibly damaging	0.90
R0971:Ptch1	UTSW	13	63539843	missense	probably benign	0.23
R1466:Ptch1	UTSW	13	63524969	missense	probably benign	0.02
R1466:Ptch1	UTSW	13	63524969	missense	probably benign	0.02
R1539:Ptch1	UTSW	13	63541287	missense	probably benign	0.00
R1616:Ptch1	UTSW	13	63539842	missense	possibly damaging	0.96
R1883:Ptch1	UTSW	13	63512027	nonsense	probably null
R1986:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2024:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2025:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2026:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2027:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2096:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2097:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2100:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2105:Ptch1	UTSW	13	63545245	missense	probably benign
R2165:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2166:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2167:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2168:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2226:Ptch1	UTSW	13	63513671	missense	probably damaging	1.00
R2437:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2504:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2507:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2696:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2698:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2698:Ptch1	UTSW	13	63542224	missense	probably damaging	1.00
R2971:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3410:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3708:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3744:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3745:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3783:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3784:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3785:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3807:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3950:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4013:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4015:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4016:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4017:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4035:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4083:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4084:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4179:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4222:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4348:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4349:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4350:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4351:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4353:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4485:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4595:Ptch1	UTSW	13	63543608	missense	possibly damaging	0.68
R4625:Ptch1	UTSW	13	63523164	missense	probably benign	0.02
R4809:Ptch1	UTSW	13	63513708	missense	probably damaging	0.98
R4904:Ptch1	UTSW	13	63523004	missense	probably damaging	1.00
R4911:Ptch1	UTSW	13	63523052	missense	probably damaging	1.00
R4942:Ptch1	UTSW	13	63525070	missense	probably benign	0.02
R5386:Ptch1	UTSW	13	63545043	missense	probably damaging	0.98
R5447:Ptch1	UTSW	13	63527245	missense	probably benign
R5604:Ptch1	UTSW	13	63525122	missense	probably benign	0.01
R5846:Ptch1	UTSW	13	63565454	unclassified	probably benign
R5926:Ptch1	UTSW	13	63545055	missense	probably benign	0.01
R5945:Ptch1	UTSW	13	63573419	utr 5 prime	probably benign
R5957:Ptch1	UTSW	13	63525115	missense	probably damaging	1.00
R6326:Ptch1	UTSW	13	63543545	missense	probably damaging	1.00
R6358:Ptch1	UTSW	13	63513689	missense	probably damaging	0.96
R6376:Ptch1	UTSW	13	63543608	missense	possibly damaging	0.68
R6599:Ptch1	UTSW	13	63523104	missense	probably damaging	0.98
R6615:Ptch1	UTSW	13	63539830	missense	possibly damaging	0.46
R6965:Ptch1	UTSW	13	63525067	missense	possibly damaging	0.63
R7149:Ptch1	UTSW	13	63511736	missense	probably benign	0.23
R7168:Ptch1	UTSW	13	63512060	missense	probably benign
R7257:Ptch1	UTSW	13	63573294	missense	not run
R7258:Ptch1	UTSW	13	63573294	missense	not run
R7259:Ptch1	UTSW	13	63573294	missense	not run
R7368:Ptch1	UTSW	13	63511984	missense	probably benign	0.06
R7525:Ptch1	UTSW	13	63511714	missense	probably benign	0.00
R7528:Ptch1	UTSW	13	63511714	missense	probably benign	0.00
R7820:Ptch1	UTSW	13	63523061	missense	probably damaging	1.00
R8077:Ptch1	UTSW	13	63540812	missense	probably damaging	0.98
R8373:Ptch1	UTSW	13	63541168	missense	probably damaging	1.00
R8398:Ptch1	UTSW	13	63525125	missense	probably benign	0.06
R8407:Ptch1	UTSW	13	63514243	missense	probably null	1.00
R8839:Ptch1	UTSW	13	63541224	missense	probably damaging	1.00
R9075:Ptch1	UTSW	13	63533521	missense	possibly damaging	0.87
R9476:Ptch1	UTSW	13	63533634	missense	probably benign	0.05
R9514:Ptch1	UTSW	13	63527257	missense	probably benign
R9528:Ptch1	UTSW	13	63513801	missense	probably benign	0.00
R9568:Ptch1	UTSW	13	63542173	missense	probably damaging	0.99
Z1177:Ptch1	UTSW	13	63520279	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AACGCTCACTTCTCAACGTG -3'
(R):5'- TGTAGTTGACTAAACAGCGTCTG -3'

Sequencing Primer
(F):5'- GCAGGGCTGTGTTCCATTACAC -3'
(R):5'- TTGACTAAACAGCGTCTGGTAGAC -3'

Posted On

2014-08-25