Incidental Mutation 'R2025:Msh5'
ID220540
Institutional Source Beutler Lab
Gene Symbol Msh5
Ensembl Gene ENSMUSG00000007035
Gene NamemutS homolog 5
SynonymsMut5, G7
MMRRC Submission 040034-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2025 (G1)
Quality Score167
Status Not validated
Chromosome17
Chromosomal Location35028605-35046745 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35032792 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 431 (I431F)
Ref Sequence ENSEMBL: ENSMUSP00000134065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007250] [ENSMUST00000040151] [ENSMUST00000097338] [ENSMUST00000172536] [ENSMUST00000174037] [ENSMUST00000174117] [ENSMUST00000174556] [ENSMUST00000174603]
Predicted Effect possibly damaging
Transcript: ENSMUST00000007250
AA Change: I431F

PolyPhen 2 Score 0.469 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000007250
Gene: ENSMUSG00000007035
AA Change: I431F

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
MUTSd 248 568 9.72e-72 SMART
MUTSac 584 775 2.2e-61 SMART
Blast:MUTSac 795 833 3e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000040151
SMART Domains Protein: ENSMUSP00000047448
Gene: ENSMUSG00000036185

DomainStartEndE-ValueType
Pfam:Suppressor_APC 35 114 2.1e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000097338
AA Change: I431F

PolyPhen 2 Score 0.469 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000094951
Gene: ENSMUSG00000007035
AA Change: I431F

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
MUTSd 248 568 9.72e-72 SMART
MUTSac 584 775 2.2e-61 SMART
Blast:MUTSac 795 833 3e-11 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000172536
AA Change: I431F

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134426
Gene: ENSMUSG00000007035
AA Change: I431F

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
MUTSd 248 568 9.72e-72 SMART
low complexity region 604 615 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173124
Predicted Effect unknown
Transcript: ENSMUST00000174026
AA Change: I49F
SMART Domains Protein: ENSMUSP00000134295
Gene: ENSMUSG00000007035
AA Change: I49F

DomainStartEndE-ValueType
MUTSac 1 166 4e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174037
SMART Domains Protein: ENSMUSP00000133881
Gene: ENSMUSG00000036185

DomainStartEndE-ValueType
low complexity region 55 65 N/A INTRINSIC
low complexity region 70 84 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174117
SMART Domains Protein: ENSMUSP00000134423
Gene: ENSMUSG00000036185

DomainStartEndE-ValueType
low complexity region 55 65 N/A INTRINSIC
low complexity region 70 84 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174556
SMART Domains Protein: ENSMUSP00000134061
Gene: ENSMUSG00000007035

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000174603
AA Change: I431F

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134065
Gene: ENSMUSG00000007035
AA Change: I431F

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
MUTSd 248 493 1.67e-11 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the MutS family of proteins that play critical roles in DNA mismatch repair and meiotic homologous recombination processes. Mice lacking the encoded protein are viable but sterile, with severe defects in spermatogenesis in males and complete loss of ovarian structures in females. Mutations in a similar gene in humans have been shown to cause common variable immune deficiency (CVID) and immunoglobulin A deficiency. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit disrupted chromosome pairing in meiosis I resulting in cell death and sterility. In males, testes size is reduced, and in females, there is a total loss of ovarian structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik T C 2: 148,782,228 F41L probably damaging Het
Abcc4 T C 14: 118,553,325 M757V probably benign Het
Acan T G 7: 79,101,222 S1914A probably benign Het
Axin2 T A 11: 108,943,078 V617D probably damaging Het
Bhlhe22 A G 3: 18,055,811 S342G probably benign Het
Cald1 AAGAGAGAGAGAGAG AAGAGAGAGAGAG 6: 34,746,173 probably null Het
Ccdc34 A G 2: 110,032,386 K179E possibly damaging Het
Clasp1 A G 1: 118,504,899 T208A probably damaging Het
Crabp1 C T 9: 54,768,468 R112* probably null Het
D130040H23Rik A G 8: 69,302,873 N310S probably benign Het
Dalrd3 T C 9: 108,571,085 I278T probably benign Het
Dbp C A 7: 45,708,276 D89E probably benign Het
Dennd2c A G 3: 103,131,689 D51G possibly damaging Het
Dido1 A T 2: 180,689,181 L158* probably null Het
Disp1 G T 1: 183,088,203 F884L probably damaging Het
Dmrtb1 T C 4: 107,683,585 D193G probably damaging Het
Dnah8 A G 17: 30,731,159 D1984G probably damaging Het
Dpf2 T C 19: 5,902,753 Y218C possibly damaging Het
Dsg4 C T 18: 20,466,636 Q770* probably null Het
Efemp1 A T 11: 28,914,696 Y250F possibly damaging Het
Erbin A T 13: 103,830,195 I1249N probably benign Het
F5 A G 1: 164,209,475 K1928E probably benign Het
Fam160a2 A G 7: 105,388,936 V260A probably damaging Het
Fam206a T A 4: 56,805,916 I138N probably damaging Het
Gdf11 T A 10: 128,891,445 I81F probably damaging Het
Gm10518 T A 1: 179,803,918 probably benign Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Grb10 G C 11: 11,970,576 S14* probably null Het
Greb1l A T 18: 10,515,221 Y562F possibly damaging Het
Gtf2ird1 T C 5: 134,363,934 E789G probably damaging Het
Hook3 T C 8: 26,038,098 E588G probably damaging Het
Hpx A G 7: 105,595,104 S266P probably damaging Het
Hs6st3 A G 14: 119,869,389 D403G probably damaging Het
Igf2bp1 A G 11: 95,974,170 V151A possibly damaging Het
Itga11 C T 9: 62,762,811 T739I probably damaging Het
Kalrn T C 16: 34,189,736 I702V probably damaging Het
Kif2b C T 11: 91,577,346 S37N probably damaging Het
Kng2 T A 16: 23,000,575 D237V probably benign Het
Krtap27-1 C A 16: 88,671,285 V124L possibly damaging Het
Lig4 A T 8: 9,972,436 L448Q probably damaging Het
Macf1 C T 4: 123,371,918 A4821T probably damaging Het
Ndufa10 A G 1: 92,439,892 Y339H probably damaging Het
Nin T A 12: 70,030,008 Q1091L probably damaging Het
Nom1 A C 5: 29,446,851 D729A probably damaging Het
Olfr671 C A 7: 104,975,244 G247V probably benign Het
P2ry14 A T 3: 59,115,445 V207E probably damaging Het
Pdss2 A T 10: 43,393,875 N238I possibly damaging Het
Pkn1 A G 8: 83,671,378 V795A probably damaging Het
Pla2g6 A C 15: 79,286,764 L804R probably damaging Het
Poglut1 A T 16: 38,537,905 probably null Het
Prkcz A T 4: 155,289,710 V83D probably damaging Het
Prss50 T C 9: 110,861,260 F157S probably benign Het
Psors1c2 A G 17: 35,534,202 probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rab7 G A 6: 88,004,179 L174F probably damaging Het
Rapgef4 A G 2: 72,242,739 T790A probably benign Het
Rb1cc1 G T 1: 6,245,309 V503L probably damaging Het
Sbf1 T A 15: 89,302,730 E815V probably damaging Het
Setd3 T A 12: 108,160,267 E104V probably damaging Het
Slc39a5 A T 10: 128,398,410 L208Q probably damaging Het
Slc39a5 G T 10: 128,398,411 L208M probably damaging Het
Slc3a1 T G 17: 85,032,845 Y232D probably damaging Het
Slc8a1 T A 17: 81,649,112 S166C probably damaging Het
Stard9 T A 2: 120,702,398 D3045E probably benign Het
Stk4 C A 2: 164,096,831 D206E probably damaging Het
Syn3 T C 10: 86,466,982 D103G probably damaging Het
Tbc1d30 T A 10: 121,279,146 Y369F probably benign Het
Tenm2 G T 11: 36,047,264 Y1527* probably null Het
Tfg T C 16: 56,705,625 K85R possibly damaging Het
Timp3 T C 10: 86,300,885 L11P probably damaging Het
Tmem144 A T 3: 79,827,711 probably null Het
Tmtc4 T C 14: 122,921,265 N682S probably benign Het
Tnks2 C T 19: 36,866,066 L464F probably damaging Het
Trank1 T C 9: 111,392,039 F2615L probably benign Het
Trio T C 15: 27,744,137 K2570E probably damaging Het
Trio T A 15: 27,773,927 D673V probably damaging Het
Ublcp1 A T 11: 44,465,631 C87S probably benign Het
Unc13a C T 8: 71,639,768 E1386K possibly damaging Het
Wdr41 C T 13: 95,018,948 H404Y probably damaging Het
Zfp280b T C 10: 76,038,494 L69S probably damaging Het
Zfp346 T C 13: 55,132,308 S282P probably damaging Het
Zfp579 C A 7: 4,993,521 E464* probably null Het
Zfp78 T A 7: 6,375,514 probably null Het
Zswim9 T C 7: 13,269,366 E186G probably damaging Het
Other mutations in Msh5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Msh5 APN 17 35029881 nonsense probably null
IGL00491:Msh5 APN 17 35030730 missense probably damaging 0.96
IGL01364:Msh5 APN 17 35028769 missense possibly damaging 0.70
R0189:Msh5 UTSW 17 35029654 missense probably null 0.97
R0257:Msh5 UTSW 17 35032864 missense probably damaging 0.99
R0346:Msh5 UTSW 17 35029888 missense probably benign 0.09
R0449:Msh5 UTSW 17 35041482 missense probably benign 0.09
R0645:Msh5 UTSW 17 35039223 missense probably damaging 1.00
R1925:Msh5 UTSW 17 35029952 missense probably benign 0.00
R1929:Msh5 UTSW 17 35044390 missense probably benign 0.24
R1970:Msh5 UTSW 17 35033600 missense probably damaging 0.99
R2038:Msh5 UTSW 17 35046040 missense probably benign 0.12
R2058:Msh5 UTSW 17 35029756 missense probably damaging 0.99
R2271:Msh5 UTSW 17 35044390 missense probably benign 0.24
R2408:Msh5 UTSW 17 35045119 missense probably damaging 1.00
R3079:Msh5 UTSW 17 35046232 missense probably benign 0.41
R4409:Msh5 UTSW 17 35039250 missense probably damaging 0.98
R4513:Msh5 UTSW 17 35030688 missense possibly damaging 0.89
R4878:Msh5 UTSW 17 35038456 missense probably damaging 1.00
R4951:Msh5 UTSW 17 35038420 nonsense probably null
R5037:Msh5 UTSW 17 35032393 missense possibly damaging 0.80
R5063:Msh5 UTSW 17 35042188 splice site probably null
R5064:Msh5 UTSW 17 35043783 intron probably benign
R5103:Msh5 UTSW 17 35029239 missense possibly damaging 0.96
R5872:Msh5 UTSW 17 35029652 critical splice donor site probably null
R6320:Msh5 UTSW 17 35029924 missense probably damaging 0.97
R6869:Msh5 UTSW 17 35041834 intron probably null
R6997:Msh5 UTSW 17 35030002 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTCACTGGGTTTAAGGACAG -3'
(R):5'- AATCAGCCTGCAGCCAGAAG -3'

Sequencing Primer
(F):5'- CCACTGACTGCCAGGGTTAATTTAG -3'
(R):5'- TGGGCTAGCCTCAAACTCAGTATATC -3'
Posted On2014-08-25