Incidental Mutation 'R1985:Rims2'
ID220541
Institutional Source Beutler Lab
Gene Symbol Rims2
Ensembl Gene ENSMUSG00000037386
Gene Nameregulating synaptic membrane exocytosis 2
Synonyms2810036I15Rik, Syt3-rs, RIM2
MMRRC Submission 039997-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.480) question?
Stock #R1985 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location39198261-39684372 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 39345314 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 171 (M171K)
Ref Sequence ENSEMBL: ENSMUSP00000080711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042917] [ENSMUST00000082054] [ENSMUST00000227243]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042917
AA Change: M131K

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000048719
Gene: ENSMUSG00000037386
AA Change: M131K

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Pfam:FYVE_2 30 154 9.5e-18 PFAM
low complexity region 315 335 N/A INTRINSIC
low complexity region 492 498 N/A INTRINSIC
low complexity region 511 521 N/A INTRINSIC
low complexity region 527 540 N/A INTRINSIC
PDZ 646 725 8.27e-16 SMART
low complexity region 740 748 N/A INTRINSIC
C2 790 897 4.08e-21 SMART
low complexity region 905 919 N/A INTRINSIC
low complexity region 1085 1101 N/A INTRINSIC
low complexity region 1116 1130 N/A INTRINSIC
low complexity region 1208 1238 N/A INTRINSIC
C2 1432 1535 3.78e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000082054
AA Change: M171K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080711
Gene: ENSMUSG00000037386
AA Change: M171K

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Pfam:FYVE_2 76 194 2.2e-11 PFAM
low complexity region 355 375 N/A INTRINSIC
low complexity region 532 538 N/A INTRINSIC
low complexity region 551 561 N/A INTRINSIC
low complexity region 567 580 N/A INTRINSIC
PDZ 686 765 8.27e-16 SMART
low complexity region 780 788 N/A INTRINSIC
C2 830 937 4.08e-21 SMART
low complexity region 945 959 N/A INTRINSIC
low complexity region 1075 1086 N/A INTRINSIC
low complexity region 1166 1196 N/A INTRINSIC
C2 1390 1493 3.78e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000227243
AA Change: M131K

PolyPhen 2 Score 0.592 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.7224 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 94% (76/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a presynaptic protein that interacts with RAB3, a protein important for normal neurotransmitter release. The encoded protein can also bind several other synaptic proteins, including UNC-13 homolog B, ELKS/Rab6-interacting/CAST family member 1, and synaptotagmin 1. This protein is involved in synaptic membrane exocytosis. Polymorphisms in this gene have been associated with degenerative lumbar scoliosis. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele show reduced body size, aberrant insulin granule exocytosis, and impaired secretion of hormones associated with glucose homeostasis. Mice homozygous for another knock-out allele show a slightly reduced body size, abnormal maternal behavior and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190007I07Rik T A 10: 82,620,217 T37S possibly damaging Het
AA792892 A T 5: 94,384,072 I272L probably benign Het
Abhd8 C A 8: 71,463,513 probably benign Het
Adam5 A T 8: 24,746,739 D648E probably benign Het
Akr1d1 A G 6: 37,558,401 D240G probably damaging Het
Ankmy2 A G 12: 36,157,364 H3R possibly damaging Het
Anpep A C 7: 79,840,857 probably null Het
Apobr A G 7: 126,587,731 T20A possibly damaging Het
Atp2a2 A T 5: 122,466,836 Y427N probably benign Het
Camkk2 A C 5: 122,764,127 S40A possibly damaging Het
Camp T C 9: 109,848,429 N112S probably benign Het
Cbx7 A G 15: 79,918,390 S229P probably damaging Het
Cnot2 T C 10: 116,527,876 N41S probably damaging Het
Dchs1 A G 7: 105,772,398 F272L possibly damaging Het
Dct T C 14: 118,036,542 K318E probably benign Het
Dhrs11 A C 11: 84,828,807 L31V probably damaging Het
Dnah7a T C 1: 53,503,934 D2359G probably benign Het
Dnajc7 A G 11: 100,590,892 S305P probably benign Het
Dscc1 CTGAATGAAT CTGAAT 15: 55,080,176 probably benign Het
Fam71b T C 11: 46,407,866 *666Q probably null Het
Flnc A G 6: 29,444,416 probably benign Het
Gm7535 A G 17: 17,911,538 probably benign Het
Grtp1 A G 8: 13,179,376 F313L probably damaging Het
Haus6 T C 4: 86,593,609 Y425C possibly damaging Het
Hdac1 T A 4: 129,528,960 N83Y possibly damaging Het
Hdlbp A G 1: 93,431,118 I237T probably damaging Het
Hfm1 A T 5: 106,898,576 D481E probably damaging Het
Hipk3 T C 2: 104,434,435 I737V probably benign Het
Il23r T A 6: 67,490,668 probably null Het
Il24 G A 1: 130,882,531 T196I probably benign Het
Ints3 C T 3: 90,400,303 probably null Het
Kcna6 T C 6: 126,738,510 E472G probably benign Het
Kcnj16 C T 11: 111,025,583 T357M probably benign Het
Kdm4b T A 17: 56,401,302 V957E probably damaging Het
Kif21b G A 1: 136,147,546 D166N probably damaging Het
Klhl11 G T 11: 100,463,244 Q584K probably benign Het
Krt9 A T 11: 100,189,991 M345K probably benign Het
Lgr5 T C 10: 115,495,245 probably benign Het
Lilr4b A T 10: 51,481,735 Q80L possibly damaging Het
Lrrc69 T C 4: 14,708,669 E225G possibly damaging Het
Ly9 A G 1: 171,599,773 S405P probably damaging Het
Myh2 A G 11: 67,180,914 D519G possibly damaging Het
Nav3 G A 10: 109,770,184 probably benign Het
Nfkb1 G A 3: 135,615,349 T215I possibly damaging Het
Ninj2 A T 6: 120,198,639 probably benign Het
Obsl1 A G 1: 75,505,600 C209R probably damaging Het
Olfr1393 T C 11: 49,280,283 I45T probably damaging Het
Olfr314 A C 11: 58,786,384 D50A probably damaging Het
Olfr531 A T 7: 140,400,800 M82K possibly damaging Het
Olfr539 G A 7: 140,667,821 C171Y probably damaging Het
Olfr619 A T 7: 103,603,672 Y6F probably benign Het
Olfr710 A G 7: 106,944,926 I25T probably benign Het
Otud4 G C 8: 79,640,012 R36P probably damaging Het
Pcnt C T 10: 76,380,337 R2239H possibly damaging Het
Pgbd5 T A 8: 124,370,592 M491L probably benign Het
Pitrm1 A T 13: 6,558,184 D316V probably damaging Het
Plod3 A G 5: 136,990,853 probably null Het
Plppr3 A T 10: 79,867,460 Y63* probably null Het
Prickle2 T C 6: 92,411,452 D323G probably damaging Het
Psmd11 A T 11: 80,445,263 I114F probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rbp3 T G 14: 33,956,461 S789A probably benign Het
Rfxap C A 3: 54,807,326 R117L probably damaging Het
Scin A G 12: 40,133,908 probably null Het
Scn11a A G 9: 119,754,678 S1624P probably benign Het
Slc41a3 G A 6: 90,642,228 V330M probably damaging Het
Slc9c1 A G 16: 45,550,106 I237V probably benign Het
Spag6 A G 2: 18,732,119 I218V probably benign Het
Stam2 T C 2: 52,709,626 T257A possibly damaging Het
Tbc1d24 G A 17: 24,207,964 R318* probably null Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Trpm3 T A 19: 22,926,082 Y1069N possibly damaging Het
Tuba8 A G 6: 121,220,520 D47G probably benign Het
Tulp3 A T 6: 128,326,806 S277T probably benign Het
Wdr7 GTT GT 18: 63,760,583 probably null Het
Ybx2 A G 11: 69,936,468 probably null Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp788 T A 7: 41,650,481 I795N probably damaging Het
Other mutations in Rims2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Rims2 APN 15 39459615 missense probably benign 0.11
IGL00502:Rims2 APN 15 39506984 missense probably damaging 1.00
IGL00556:Rims2 APN 15 39456674 splice site probably null
IGL00811:Rims2 APN 15 39292149 missense probably damaging 1.00
IGL00827:Rims2 APN 15 39472359 missense probably damaging 0.99
IGL01642:Rims2 APN 15 39457796 missense probably damaging 1.00
IGL02951:Rims2 APN 15 39534938 missense probably damaging 1.00
IGL03009:Rims2 APN 15 39566997 missense possibly damaging 0.85
IGL03080:Rims2 APN 15 39535903 missense probably damaging 1.00
IGL03102:Rims2 APN 15 39459593 missense possibly damaging 0.95
IGL03252:Rims2 APN 15 39452352 missense probably benign
IGL03365:Rims2 APN 15 39476541 missense probably damaging 1.00
IGL03393:Rims2 APN 15 39462613 splice site probably null
IGL03409:Rims2 APN 15 39456733 missense probably damaging 1.00
PIT4486001:Rims2 UTSW 15 39476520 missense possibly damaging 0.67
R0009:Rims2 UTSW 15 39534966 missense probably damaging 0.99
R0009:Rims2 UTSW 15 39534966 missense probably damaging 0.99
R0078:Rims2 UTSW 15 39534855 missense probably benign 0.42
R0367:Rims2 UTSW 15 39462615 splice site probably null
R0401:Rims2 UTSW 15 39509632 splice site probably benign
R0531:Rims2 UTSW 15 39567030 missense probably damaging 1.00
R0791:Rims2 UTSW 15 39679625 splice site probably benign
R0838:Rims2 UTSW 15 39681025 missense probably benign 0.02
R1201:Rims2 UTSW 15 39616324 missense possibly damaging 0.91
R1318:Rims2 UTSW 15 39517826 missense probably damaging 0.99
R1457:Rims2 UTSW 15 39511314 missense possibly damaging 0.63
R1619:Rims2 UTSW 15 39506986 missense probably damaging 1.00
R1672:Rims2 UTSW 15 39292189 missense probably benign 0.09
R1743:Rims2 UTSW 15 39679650 missense probably benign 0.10
R1766:Rims2 UTSW 15 39462580 missense probably damaging 0.99
R1779:Rims2 UTSW 15 39681702 missense probably damaging 1.00
R1804:Rims2 UTSW 15 39437043 nonsense probably null
R1986:Rims2 UTSW 15 39345314 missense probably damaging 0.99
R2113:Rims2 UTSW 15 39511326 missense probably benign 0.17
R2260:Rims2 UTSW 15 39478566 nonsense probably null
R2510:Rims2 UTSW 15 39585652 missense probably damaging 1.00
R3693:Rims2 UTSW 15 39478575 missense probably benign 0.01
R3937:Rims2 UTSW 15 39437845 missense probably damaging 1.00
R4425:Rims2 UTSW 15 39437924 critical splice donor site probably null
R4453:Rims2 UTSW 15 39292208 missense probably damaging 1.00
R4474:Rims2 UTSW 15 39462560 missense probably damaging 1.00
R4518:Rims2 UTSW 15 39437526 missense probably damaging 1.00
R4526:Rims2 UTSW 15 39437717 missense probably damaging 1.00
R4833:Rims2 UTSW 15 39535914 missense probably damaging 0.98
R4936:Rims2 UTSW 15 39437728 missense probably damaging 1.00
R4993:Rims2 UTSW 15 39454445 missense possibly damaging 0.90
R5001:Rims2 UTSW 15 39452428 missense probably benign 0.03
R5054:Rims2 UTSW 15 39517869 intron probably null
R5072:Rims2 UTSW 15 39462590 missense probably benign 0.01
R5171:Rims2 UTSW 15 39437103 missense probably damaging 1.00
R5429:Rims2 UTSW 15 39345355 missense probably damaging 1.00
R5623:Rims2 UTSW 15 39478615 missense probably damaging 1.00
R5624:Rims2 UTSW 15 39345413 missense possibly damaging 0.46
R5685:Rims2 UTSW 15 39437206 missense possibly damaging 0.67
R5784:Rims2 UTSW 15 39535987 splice site probably null
R5790:Rims2 UTSW 15 39681045 missense probably damaging 1.00
R5822:Rims2 UTSW 15 39476490 missense probably damaging 1.00
R5963:Rims2 UTSW 15 39437182 missense probably damaging 1.00
R5988:Rims2 UTSW 15 39292182 missense probably damaging 1.00
R6057:Rims2 UTSW 15 39675020 missense probably damaging 1.00
R6239:Rims2 UTSW 15 39198363 start codon destroyed unknown
R6407:Rims2 UTSW 15 39452328 missense probably damaging 1.00
R6418:Rims2 UTSW 15 39509696 missense probably damaging 1.00
R6495:Rims2 UTSW 15 39517812 missense probably benign 0.01
R6502:Rims2 UTSW 15 39534855 missense probably benign 0.42
R6753:Rims2 UTSW 15 39566973 missense possibly damaging 0.74
R6855:Rims2 UTSW 15 39345515 missense probably benign 0.06
R6948:Rims2 UTSW 15 39511341 missense probably benign
R7058:Rims2 UTSW 15 39585648 missense probably damaging 1.00
R7167:Rims2 UTSW 15 39437077 missense probably benign
R7217:Rims2 UTSW 15 39476489 missense probably damaging 0.99
R7223:Rims2 UTSW 15 39437032 missense probably benign 0.30
R7289:Rims2 UTSW 15 39437718 missense probably benign 0.00
R7459:Rims2 UTSW 15 39517839 missense probably benign
R7663:Rims2 UTSW 15 39507026 missense probably damaging 1.00
X0034:Rims2 UTSW 15 39437534 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTGAAAGCTTTACTTCCCG -3'
(R):5'- ATAAGTCACCTGGGGCTCCTTG -3'

Sequencing Primer
(F):5'- CAAATCGACTGTCTCTCAAATTCATC -3'
(R):5'- CTGGGGCTCCTTGGAACTG -3'
Posted On2014-08-25