Incidental Mutation 'R2025:Greb1l'
ID 220547
Institutional Source Beutler Lab
Gene Symbol Greb1l
Ensembl Gene ENSMUSG00000042942
Gene Name growth regulation by estrogen in breast cancer-like
Synonyms mKIAA4095, AK220484
MMRRC Submission 040034-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2025 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 10325177-10562940 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 10515221 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 562 (Y562F)
Ref Sequence ENSEMBL: ENSMUSP00000134090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532] [ENSMUST00000172680]
AlphaFold B9EJV3
Predicted Effect probably benign
Transcript: ENSMUST00000048977
AA Change: Y671F

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: Y671F

DomainStartEndE-ValueType
Pfam:GREB1 1 1172 N/A PFAM
Pfam:GREB1 1154 1913 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172532
AA Change: Y562F

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942
AA Change: Y562F

DomainStartEndE-ValueType
low complexity region 83 100 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172680
AA Change: Y72F

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942
AA Change: Y72F

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174553
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 T C 14: 118,790,737 (GRCm39) M757V probably benign Het
Abitram T A 4: 56,805,916 (GRCm39) I138N probably damaging Het
Acan T G 7: 78,750,970 (GRCm39) S1914A probably benign Het
Axin2 T A 11: 108,833,904 (GRCm39) V617D probably damaging Het
Bhlhe22 A G 3: 18,109,975 (GRCm39) S342G probably benign Het
Cald1 AAGAGAGAGAGAGAG AAGAGAGAGAGAG 6: 34,723,108 (GRCm39) probably null Het
Ccdc34 A G 2: 109,862,731 (GRCm39) K179E possibly damaging Het
Clasp1 A G 1: 118,432,629 (GRCm39) T208A probably damaging Het
Crabp1 C T 9: 54,675,752 (GRCm39) R112* probably null Het
Cstdc1 T C 2: 148,624,148 (GRCm39) F41L probably damaging Het
D130040H23Rik A G 8: 69,755,525 (GRCm39) N310S probably benign Het
Dalrd3 T C 9: 108,448,284 (GRCm39) I278T probably benign Het
Dbp C A 7: 45,357,700 (GRCm39) D89E probably benign Het
Dennd2c A G 3: 103,039,005 (GRCm39) D51G possibly damaging Het
Dido1 A T 2: 180,330,974 (GRCm39) L158* probably null Het
Disp1 G T 1: 182,869,767 (GRCm39) F884L probably damaging Het
Dmrtb1 T C 4: 107,540,782 (GRCm39) D193G probably damaging Het
Dnah8 A G 17: 30,950,133 (GRCm39) D1984G probably damaging Het
Dpf2 T C 19: 5,952,781 (GRCm39) Y218C possibly damaging Het
Dsg4 C T 18: 20,599,693 (GRCm39) Q770* probably null Het
Efemp1 A T 11: 28,864,696 (GRCm39) Y250F possibly damaging Het
Erbin A T 13: 103,966,703 (GRCm39) I1249N probably benign Het
F5 A G 1: 164,037,044 (GRCm39) K1928E probably benign Het
Fhip1b A G 7: 105,038,143 (GRCm39) V260A probably damaging Het
Gdf11 T A 10: 128,727,314 (GRCm39) I81F probably damaging Het
Gm10518 T A 1: 179,631,483 (GRCm39) probably benign Het
Grb10 G C 11: 11,920,576 (GRCm39) S14* probably null Het
Gtf2ird1 T C 5: 134,392,788 (GRCm39) E789G probably damaging Het
Hook3 T C 8: 26,528,126 (GRCm39) E588G probably damaging Het
Hpx A G 7: 105,244,311 (GRCm39) S266P probably damaging Het
Hs6st3 A G 14: 120,106,801 (GRCm39) D403G probably damaging Het
Igf2bp1 A G 11: 95,864,996 (GRCm39) V151A possibly damaging Het
Itga11 C T 9: 62,670,093 (GRCm39) T739I probably damaging Het
Kalrn T C 16: 34,010,106 (GRCm39) I702V probably damaging Het
Kif2b C T 11: 91,468,172 (GRCm39) S37N probably damaging Het
Kng2 T A 16: 22,819,325 (GRCm39) D237V probably benign Het
Krtap27-1 C A 16: 88,468,173 (GRCm39) V124L possibly damaging Het
Lig4 A T 8: 10,022,436 (GRCm39) L448Q probably damaging Het
Macf1 C T 4: 123,265,711 (GRCm39) A4821T probably damaging Het
Msh5 T A 17: 35,251,768 (GRCm39) I431F possibly damaging Het
Ndufa10 A G 1: 92,367,614 (GRCm39) Y339H probably damaging Het
Nin T A 12: 70,076,782 (GRCm39) Q1091L probably damaging Het
Nom1 A C 5: 29,651,849 (GRCm39) D729A probably damaging Het
Or52e8 C A 7: 104,624,451 (GRCm39) G247V probably benign Het
P2ry14 A T 3: 59,022,866 (GRCm39) V207E probably damaging Het
Pdss2 A T 10: 43,269,871 (GRCm39) N238I possibly damaging Het
Pkn1 A G 8: 84,398,007 (GRCm39) V795A probably damaging Het
Pla2g6 A C 15: 79,170,964 (GRCm39) L804R probably damaging Het
Poglut1 A T 16: 38,358,267 (GRCm39) probably null Het
Prkcz A T 4: 155,374,167 (GRCm39) V83D probably damaging Het
Prss50 T C 9: 110,690,328 (GRCm39) F157S probably benign Het
Psors1c2 A G 17: 35,845,099 (GRCm39) probably benign Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Pwwp4a G T X: 72,171,261 (GRCm39) G218C probably damaging Het
Rab7 G A 6: 87,981,161 (GRCm39) L174F probably damaging Het
Rapgef4 A G 2: 72,073,083 (GRCm39) T790A probably benign Het
Rb1cc1 G T 1: 6,315,533 (GRCm39) V503L probably damaging Het
Sbf1 T A 15: 89,186,933 (GRCm39) E815V probably damaging Het
Setd3 T A 12: 108,126,526 (GRCm39) E104V probably damaging Het
Slc39a5 A T 10: 128,234,279 (GRCm39) L208Q probably damaging Het
Slc39a5 G T 10: 128,234,280 (GRCm39) L208M probably damaging Het
Slc3a1 T G 17: 85,340,273 (GRCm39) Y232D probably damaging Het
Slc8a1 T A 17: 81,956,541 (GRCm39) S166C probably damaging Het
Stard9 T A 2: 120,532,879 (GRCm39) D3045E probably benign Het
Stk4 C A 2: 163,938,751 (GRCm39) D206E probably damaging Het
Syn3 T C 10: 86,302,846 (GRCm39) D103G probably damaging Het
Tbc1d30 T A 10: 121,115,051 (GRCm39) Y369F probably benign Het
Tenm2 G T 11: 35,938,091 (GRCm39) Y1527* probably null Het
Tfg T C 16: 56,525,988 (GRCm39) K85R possibly damaging Het
Timp3 T C 10: 86,136,749 (GRCm39) L11P probably damaging Het
Tmem144 A T 3: 79,735,018 (GRCm39) probably null Het
Tmtc4 T C 14: 123,158,677 (GRCm39) N682S probably benign Het
Tnks2 C T 19: 36,843,466 (GRCm39) L464F probably damaging Het
Trank1 T C 9: 111,221,107 (GRCm39) F2615L probably benign Het
Trio T C 15: 27,744,223 (GRCm39) K2570E probably damaging Het
Trio T A 15: 27,774,013 (GRCm39) D673V probably damaging Het
Ublcp1 A T 11: 44,356,458 (GRCm39) C87S probably benign Het
Unc13a C T 8: 72,092,412 (GRCm39) E1386K possibly damaging Het
Wdr41 C T 13: 95,155,456 (GRCm39) H404Y probably damaging Het
Zfp280b T C 10: 75,874,328 (GRCm39) L69S probably damaging Het
Zfp346 T C 13: 55,280,121 (GRCm39) S282P probably damaging Het
Zfp579 C A 7: 4,996,520 (GRCm39) E464* probably null Het
Zfp78 T A 7: 6,378,513 (GRCm39) probably null Het
Zswim9 T C 7: 13,003,292 (GRCm39) E186G probably damaging Het
Other mutations in Greb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Greb1l APN 18 10,555,962 (GRCm39) missense possibly damaging 0.90
IGL01554:Greb1l APN 18 10,522,144 (GRCm39) missense probably benign 0.01
IGL01563:Greb1l APN 18 10,469,399 (GRCm39) missense probably damaging 0.99
IGL01944:Greb1l APN 18 10,557,280 (GRCm39) missense possibly damaging 0.91
IGL02110:Greb1l APN 18 10,515,271 (GRCm39) missense probably damaging 1.00
IGL02249:Greb1l APN 18 10,532,961 (GRCm39) missense probably damaging 1.00
IGL02318:Greb1l APN 18 10,469,388 (GRCm39) missense possibly damaging 0.91
IGL02340:Greb1l APN 18 10,515,200 (GRCm39) missense probably damaging 0.99
IGL02516:Greb1l APN 18 10,537,064 (GRCm39) missense probably benign 0.31
IGL02566:Greb1l APN 18 10,503,299 (GRCm39) missense probably damaging 0.99
IGL02583:Greb1l APN 18 10,542,362 (GRCm39) missense probably damaging 1.00
IGL02838:Greb1l APN 18 10,560,430 (GRCm39) missense probably damaging 1.00
A4554:Greb1l UTSW 18 10,532,862 (GRCm39) missense possibly damaging 0.58
PIT4453001:Greb1l UTSW 18 10,533,032 (GRCm39) missense probably benign 0.08
PIT4453001:Greb1l UTSW 18 10,533,031 (GRCm39) missense probably damaging 0.98
R0099:Greb1l UTSW 18 10,509,158 (GRCm39) missense probably damaging 1.00
R0226:Greb1l UTSW 18 10,522,076 (GRCm39) intron probably benign
R0234:Greb1l UTSW 18 10,560,331 (GRCm39) missense probably damaging 1.00
R0234:Greb1l UTSW 18 10,560,331 (GRCm39) missense probably damaging 1.00
R0239:Greb1l UTSW 18 10,458,567 (GRCm39) splice site probably benign
R0316:Greb1l UTSW 18 10,547,420 (GRCm39) missense probably damaging 1.00
R0369:Greb1l UTSW 18 10,469,375 (GRCm39) missense possibly damaging 0.80
R0394:Greb1l UTSW 18 10,523,374 (GRCm39) missense probably damaging 0.99
R0478:Greb1l UTSW 18 10,509,281 (GRCm39) missense probably damaging 1.00
R0555:Greb1l UTSW 18 10,458,781 (GRCm39) splice site probably benign
R0671:Greb1l UTSW 18 10,474,303 (GRCm39) missense probably damaging 1.00
R1282:Greb1l UTSW 18 10,547,289 (GRCm39) missense probably benign 0.13
R1574:Greb1l UTSW 18 10,554,997 (GRCm39) missense possibly damaging 0.95
R1574:Greb1l UTSW 18 10,554,997 (GRCm39) missense possibly damaging 0.95
R1607:Greb1l UTSW 18 10,529,703 (GRCm39) missense possibly damaging 0.85
R1666:Greb1l UTSW 18 10,529,708 (GRCm39) critical splice donor site probably null
R1666:Greb1l UTSW 18 10,501,080 (GRCm39) critical splice donor site probably null
R1720:Greb1l UTSW 18 10,553,848 (GRCm39) missense probably benign 0.19
R1808:Greb1l UTSW 18 10,542,143 (GRCm39) missense probably benign
R1829:Greb1l UTSW 18 10,509,314 (GRCm39) missense probably damaging 1.00
R1897:Greb1l UTSW 18 10,498,992 (GRCm39) missense probably benign 0.00
R1967:Greb1l UTSW 18 10,501,049 (GRCm39) missense possibly damaging 0.91
R2086:Greb1l UTSW 18 10,523,281 (GRCm39) missense probably damaging 1.00
R2125:Greb1l UTSW 18 10,511,422 (GRCm39) missense probably damaging 0.98
R2139:Greb1l UTSW 18 10,555,011 (GRCm39) missense probably damaging 1.00
R2255:Greb1l UTSW 18 10,554,857 (GRCm39) missense probably damaging 1.00
R2256:Greb1l UTSW 18 10,503,307 (GRCm39) missense possibly damaging 0.91
R2257:Greb1l UTSW 18 10,503,307 (GRCm39) missense possibly damaging 0.91
R2880:Greb1l UTSW 18 10,547,288 (GRCm39) missense possibly damaging 0.93
R3623:Greb1l UTSW 18 10,542,380 (GRCm39) missense probably damaging 0.99
R3778:Greb1l UTSW 18 10,469,444 (GRCm39) missense possibly damaging 0.60
R3975:Greb1l UTSW 18 10,522,247 (GRCm39) missense possibly damaging 0.71
R4038:Greb1l UTSW 18 10,515,209 (GRCm39) missense possibly damaging 0.93
R4062:Greb1l UTSW 18 10,522,150 (GRCm39) missense probably damaging 0.99
R4134:Greb1l UTSW 18 10,529,708 (GRCm39) critical splice donor site probably null
R4342:Greb1l UTSW 18 10,544,561 (GRCm39) missense probably benign 0.12
R4409:Greb1l UTSW 18 10,503,182 (GRCm39) missense possibly damaging 0.70
R4600:Greb1l UTSW 18 10,553,705 (GRCm39) missense probably damaging 1.00
R4618:Greb1l UTSW 18 10,498,965 (GRCm39) missense probably benign 0.00
R4683:Greb1l UTSW 18 10,529,563 (GRCm39) splice site probably null
R4686:Greb1l UTSW 18 10,522,112 (GRCm39) missense probably damaging 0.98
R4707:Greb1l UTSW 18 10,532,922 (GRCm39) missense probably benign 0.02
R4780:Greb1l UTSW 18 10,541,792 (GRCm39) missense probably benign 0.00
R4819:Greb1l UTSW 18 10,458,358 (GRCm39) missense probably damaging 1.00
R4925:Greb1l UTSW 18 10,547,447 (GRCm39) missense possibly damaging 0.79
R4960:Greb1l UTSW 18 10,547,306 (GRCm39) missense probably damaging 0.99
R5150:Greb1l UTSW 18 10,555,950 (GRCm39) frame shift probably null
R5154:Greb1l UTSW 18 10,458,312 (GRCm39) missense probably benign 0.02
R5269:Greb1l UTSW 18 10,511,409 (GRCm39) missense probably benign
R5290:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5310:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5328:Greb1l UTSW 18 10,553,720 (GRCm39) missense probably damaging 1.00
R5337:Greb1l UTSW 18 10,509,143 (GRCm39) missense probably damaging 1.00
R5393:Greb1l UTSW 18 10,458,312 (GRCm39) missense probably benign 0.02
R5402:Greb1l UTSW 18 10,537,169 (GRCm39) missense probably benign 0.26
R5718:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5719:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5720:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5721:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5902:Greb1l UTSW 18 10,538,302 (GRCm39) missense probably benign 0.00
R5993:Greb1l UTSW 18 10,544,455 (GRCm39) missense probably benign 0.10
R6035:Greb1l UTSW 18 10,501,025 (GRCm39) missense possibly damaging 0.91
R6035:Greb1l UTSW 18 10,501,025 (GRCm39) missense possibly damaging 0.91
R6045:Greb1l UTSW 18 10,547,068 (GRCm39) missense probably damaging 1.00
R6063:Greb1l UTSW 18 10,557,340 (GRCm39) missense probably damaging 1.00
R6297:Greb1l UTSW 18 10,469,494 (GRCm39) missense probably damaging 1.00
R6405:Greb1l UTSW 18 10,501,076 (GRCm39) missense probably benign 0.30
R6552:Greb1l UTSW 18 10,541,814 (GRCm39) missense probably benign 0.00
R6572:Greb1l UTSW 18 10,522,131 (GRCm39) missense probably benign 0.07
R6575:Greb1l UTSW 18 10,547,347 (GRCm39) missense possibly damaging 0.88
R6922:Greb1l UTSW 18 10,547,482 (GRCm39) missense possibly damaging 0.88
R6957:Greb1l UTSW 18 10,558,786 (GRCm39) missense probably benign 0.23
R6962:Greb1l UTSW 18 10,547,327 (GRCm39) missense probably damaging 1.00
R7012:Greb1l UTSW 18 10,529,707 (GRCm39) critical splice donor site probably null
R7179:Greb1l UTSW 18 10,544,576 (GRCm39) missense probably benign 0.00
R7251:Greb1l UTSW 18 10,515,319 (GRCm39) missense probably damaging 1.00
R7275:Greb1l UTSW 18 10,544,561 (GRCm39) missense probably benign 0.12
R7301:Greb1l UTSW 18 10,544,970 (GRCm39) missense probably damaging 1.00
R7307:Greb1l UTSW 18 10,538,142 (GRCm39) missense probably damaging 0.99
R7455:Greb1l UTSW 18 10,554,915 (GRCm39) missense probably damaging 1.00
R7832:Greb1l UTSW 18 10,542,056 (GRCm39) missense probably benign 0.38
R7934:Greb1l UTSW 18 10,474,371 (GRCm39) nonsense probably null
R8137:Greb1l UTSW 18 10,474,357 (GRCm39) missense possibly damaging 0.77
R8138:Greb1l UTSW 18 10,533,060 (GRCm39) missense probably benign 0.13
R8208:Greb1l UTSW 18 10,510,703 (GRCm39) missense probably damaging 1.00
R8227:Greb1l UTSW 18 10,515,371 (GRCm39) missense probably damaging 1.00
R8312:Greb1l UTSW 18 10,511,587 (GRCm39) intron probably benign
R8331:Greb1l UTSW 18 10,458,706 (GRCm39) missense possibly damaging 0.96
R8364:Greb1l UTSW 18 10,529,687 (GRCm39) missense possibly damaging 0.85
R8389:Greb1l UTSW 18 10,529,613 (GRCm39) missense probably benign 0.00
R8695:Greb1l UTSW 18 10,544,450 (GRCm39) missense probably benign 0.01
R8795:Greb1l UTSW 18 10,553,739 (GRCm39) missense probably damaging 0.98
R8836:Greb1l UTSW 18 10,509,257 (GRCm39) missense probably benign 0.30
R8862:Greb1l UTSW 18 10,555,042 (GRCm39) missense possibly damaging 0.90
R8872:Greb1l UTSW 18 10,529,684 (GRCm39) missense probably benign 0.18
R8874:Greb1l UTSW 18 10,544,896 (GRCm39) missense probably benign 0.01
R8886:Greb1l UTSW 18 10,553,843 (GRCm39) missense probably benign 0.21
R8921:Greb1l UTSW 18 10,541,825 (GRCm39) missense probably benign 0.01
R8997:Greb1l UTSW 18 10,510,747 (GRCm39) missense probably damaging 1.00
R9015:Greb1l UTSW 18 10,541,675 (GRCm39) missense probably benign 0.00
R9018:Greb1l UTSW 18 10,542,004 (GRCm39) missense possibly damaging 0.76
R9074:Greb1l UTSW 18 10,558,795 (GRCm39) missense probably damaging 1.00
R9074:Greb1l UTSW 18 10,532,797 (GRCm39) missense probably damaging 1.00
R9117:Greb1l UTSW 18 10,542,422 (GRCm39) missense probably benign 0.31
R9189:Greb1l UTSW 18 10,499,983 (GRCm39) missense probably benign
R9332:Greb1l UTSW 18 10,532,796 (GRCm39) missense possibly damaging 0.92
R9367:Greb1l UTSW 18 10,522,130 (GRCm39) missense probably benign 0.00
R9497:Greb1l UTSW 18 10,458,600 (GRCm39) missense probably benign 0.00
R9796:Greb1l UTSW 18 10,538,233 (GRCm39) missense possibly damaging 0.69
Z1176:Greb1l UTSW 18 10,515,305 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGATTTCAGGGGTAAACAGGC -3'
(R):5'- TGGAAGCTCACAGAAAGGCTC -3'

Sequencing Primer
(F):5'- GGCAACTCCATAAAGCCCGG -3'
(R):5'- GAAAGGCTCACTCTCACCTGACTG -3'
Posted On 2014-08-25