Incidental Mutation 'R2025:Dsg4'
ID 220549
Institutional Source Beutler Lab
Gene Symbol Dsg4
Ensembl Gene ENSMUSG00000001804
Gene Name desmoglein 4
Synonyms CDHF13, lah
MMRRC Submission 040034-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.507) question?
Stock # R2025 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 20569232-20604878 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 20599693 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 770 (Q770*)
Ref Sequence ENSEMBL: ENSMUSP00000019426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019426]
AlphaFold Q7TMD7
Predicted Effect probably null
Transcript: ENSMUST00000019426
AA Change: Q770*
SMART Domains Protein: ENSMUSP00000019426
Gene: ENSMUSG00000001804
AA Change: Q770*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 70 155 1.54e-11 SMART
CA 179 267 4.27e-19 SMART
CA 290 384 5.48e-8 SMART
CA 411 495 9.4e-7 SMART
transmembrane domain 634 656 N/A INTRINSIC
low complexity region 724 736 N/A INTRINSIC
Pfam:Cadherin_C 749 849 3.1e-8 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. This gene is expressed in the suprabasal epidermis and hair follicle. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the lanceolate hair phenotype in mice. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice carrying mutations at this locus exhibit abnormalities in hair growth, vibrissae growth, and a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 T C 14: 118,790,737 (GRCm39) M757V probably benign Het
Abitram T A 4: 56,805,916 (GRCm39) I138N probably damaging Het
Acan T G 7: 78,750,970 (GRCm39) S1914A probably benign Het
Axin2 T A 11: 108,833,904 (GRCm39) V617D probably damaging Het
Bhlhe22 A G 3: 18,109,975 (GRCm39) S342G probably benign Het
Cald1 AAGAGAGAGAGAGAG AAGAGAGAGAGAG 6: 34,723,108 (GRCm39) probably null Het
Ccdc34 A G 2: 109,862,731 (GRCm39) K179E possibly damaging Het
Clasp1 A G 1: 118,432,629 (GRCm39) T208A probably damaging Het
Crabp1 C T 9: 54,675,752 (GRCm39) R112* probably null Het
Cstdc1 T C 2: 148,624,148 (GRCm39) F41L probably damaging Het
D130040H23Rik A G 8: 69,755,525 (GRCm39) N310S probably benign Het
Dalrd3 T C 9: 108,448,284 (GRCm39) I278T probably benign Het
Dbp C A 7: 45,357,700 (GRCm39) D89E probably benign Het
Dennd2c A G 3: 103,039,005 (GRCm39) D51G possibly damaging Het
Dido1 A T 2: 180,330,974 (GRCm39) L158* probably null Het
Disp1 G T 1: 182,869,767 (GRCm39) F884L probably damaging Het
Dmrtb1 T C 4: 107,540,782 (GRCm39) D193G probably damaging Het
Dnah8 A G 17: 30,950,133 (GRCm39) D1984G probably damaging Het
Dpf2 T C 19: 5,952,781 (GRCm39) Y218C possibly damaging Het
Efemp1 A T 11: 28,864,696 (GRCm39) Y250F possibly damaging Het
Erbin A T 13: 103,966,703 (GRCm39) I1249N probably benign Het
F5 A G 1: 164,037,044 (GRCm39) K1928E probably benign Het
Fhip1b A G 7: 105,038,143 (GRCm39) V260A probably damaging Het
Gdf11 T A 10: 128,727,314 (GRCm39) I81F probably damaging Het
Gm10518 T A 1: 179,631,483 (GRCm39) probably benign Het
Grb10 G C 11: 11,920,576 (GRCm39) S14* probably null Het
Greb1l A T 18: 10,515,221 (GRCm39) Y562F possibly damaging Het
Gtf2ird1 T C 5: 134,392,788 (GRCm39) E789G probably damaging Het
Hook3 T C 8: 26,528,126 (GRCm39) E588G probably damaging Het
Hpx A G 7: 105,244,311 (GRCm39) S266P probably damaging Het
Hs6st3 A G 14: 120,106,801 (GRCm39) D403G probably damaging Het
Igf2bp1 A G 11: 95,864,996 (GRCm39) V151A possibly damaging Het
Itga11 C T 9: 62,670,093 (GRCm39) T739I probably damaging Het
Kalrn T C 16: 34,010,106 (GRCm39) I702V probably damaging Het
Kif2b C T 11: 91,468,172 (GRCm39) S37N probably damaging Het
Kng2 T A 16: 22,819,325 (GRCm39) D237V probably benign Het
Krtap27-1 C A 16: 88,468,173 (GRCm39) V124L possibly damaging Het
Lig4 A T 8: 10,022,436 (GRCm39) L448Q probably damaging Het
Macf1 C T 4: 123,265,711 (GRCm39) A4821T probably damaging Het
Msh5 T A 17: 35,251,768 (GRCm39) I431F possibly damaging Het
Ndufa10 A G 1: 92,367,614 (GRCm39) Y339H probably damaging Het
Nin T A 12: 70,076,782 (GRCm39) Q1091L probably damaging Het
Nom1 A C 5: 29,651,849 (GRCm39) D729A probably damaging Het
Or52e8 C A 7: 104,624,451 (GRCm39) G247V probably benign Het
P2ry14 A T 3: 59,022,866 (GRCm39) V207E probably damaging Het
Pdss2 A T 10: 43,269,871 (GRCm39) N238I possibly damaging Het
Pkn1 A G 8: 84,398,007 (GRCm39) V795A probably damaging Het
Pla2g6 A C 15: 79,170,964 (GRCm39) L804R probably damaging Het
Poglut1 A T 16: 38,358,267 (GRCm39) probably null Het
Prkcz A T 4: 155,374,167 (GRCm39) V83D probably damaging Het
Prss50 T C 9: 110,690,328 (GRCm39) F157S probably benign Het
Psors1c2 A G 17: 35,845,099 (GRCm39) probably benign Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Pwwp4a G T X: 72,171,261 (GRCm39) G218C probably damaging Het
Rab7 G A 6: 87,981,161 (GRCm39) L174F probably damaging Het
Rapgef4 A G 2: 72,073,083 (GRCm39) T790A probably benign Het
Rb1cc1 G T 1: 6,315,533 (GRCm39) V503L probably damaging Het
Sbf1 T A 15: 89,186,933 (GRCm39) E815V probably damaging Het
Setd3 T A 12: 108,126,526 (GRCm39) E104V probably damaging Het
Slc39a5 A T 10: 128,234,279 (GRCm39) L208Q probably damaging Het
Slc39a5 G T 10: 128,234,280 (GRCm39) L208M probably damaging Het
Slc3a1 T G 17: 85,340,273 (GRCm39) Y232D probably damaging Het
Slc8a1 T A 17: 81,956,541 (GRCm39) S166C probably damaging Het
Stard9 T A 2: 120,532,879 (GRCm39) D3045E probably benign Het
Stk4 C A 2: 163,938,751 (GRCm39) D206E probably damaging Het
Syn3 T C 10: 86,302,846 (GRCm39) D103G probably damaging Het
Tbc1d30 T A 10: 121,115,051 (GRCm39) Y369F probably benign Het
Tenm2 G T 11: 35,938,091 (GRCm39) Y1527* probably null Het
Tfg T C 16: 56,525,988 (GRCm39) K85R possibly damaging Het
Timp3 T C 10: 86,136,749 (GRCm39) L11P probably damaging Het
Tmem144 A T 3: 79,735,018 (GRCm39) probably null Het
Tmtc4 T C 14: 123,158,677 (GRCm39) N682S probably benign Het
Tnks2 C T 19: 36,843,466 (GRCm39) L464F probably damaging Het
Trank1 T C 9: 111,221,107 (GRCm39) F2615L probably benign Het
Trio T C 15: 27,744,223 (GRCm39) K2570E probably damaging Het
Trio T A 15: 27,774,013 (GRCm39) D673V probably damaging Het
Ublcp1 A T 11: 44,356,458 (GRCm39) C87S probably benign Het
Unc13a C T 8: 72,092,412 (GRCm39) E1386K possibly damaging Het
Wdr41 C T 13: 95,155,456 (GRCm39) H404Y probably damaging Het
Zfp280b T C 10: 75,874,328 (GRCm39) L69S probably damaging Het
Zfp346 T C 13: 55,280,121 (GRCm39) S282P probably damaging Het
Zfp579 C A 7: 4,996,520 (GRCm39) E464* probably null Het
Zfp78 T A 7: 6,378,513 (GRCm39) probably null Het
Zswim9 T C 7: 13,003,292 (GRCm39) E186G probably damaging Het
Other mutations in Dsg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Dsg4 APN 18 20,594,383 (GRCm39) missense probably benign 0.22
IGL01723:Dsg4 APN 18 20,599,567 (GRCm39) missense probably damaging 1.00
IGL02249:Dsg4 APN 18 20,594,361 (GRCm39) missense possibly damaging 0.69
IGL02445:Dsg4 APN 18 20,579,307 (GRCm39) splice site probably benign
IGL02553:Dsg4 APN 18 20,595,577 (GRCm39) missense probably benign
IGL02578:Dsg4 APN 18 20,604,250 (GRCm39) missense possibly damaging 0.94
IGL02634:Dsg4 APN 18 20,591,637 (GRCm39) missense probably benign 0.01
IGL02677:Dsg4 APN 18 20,597,933 (GRCm39) missense possibly damaging 0.62
IGL02741:Dsg4 APN 18 20,604,553 (GRCm39) missense probably benign
IGL02747:Dsg4 APN 18 20,579,995 (GRCm39) missense probably damaging 0.97
IGL03342:Dsg4 APN 18 20,584,880 (GRCm39) missense probably damaging 1.00
burrito UTSW 18 20,584,919 (GRCm39) missense possibly damaging 0.81
woodshed UTSW 18 20,584,929 (GRCm39) nonsense probably null
R0043:Dsg4 UTSW 18 20,586,029 (GRCm39) missense probably damaging 1.00
R0375:Dsg4 UTSW 18 20,603,936 (GRCm39) missense probably damaging 1.00
R0537:Dsg4 UTSW 18 20,591,628 (GRCm39) missense probably damaging 1.00
R0619:Dsg4 UTSW 18 20,594,416 (GRCm39) missense probably benign 0.00
R0622:Dsg4 UTSW 18 20,582,845 (GRCm39) missense possibly damaging 0.51
R0765:Dsg4 UTSW 18 20,587,703 (GRCm39) splice site probably benign
R0786:Dsg4 UTSW 18 20,582,429 (GRCm39) critical splice donor site probably null
R1114:Dsg4 UTSW 18 20,599,540 (GRCm39) missense possibly damaging 0.62
R1249:Dsg4 UTSW 18 20,579,929 (GRCm39) nonsense probably null
R1372:Dsg4 UTSW 18 20,582,733 (GRCm39) splice site probably null
R1382:Dsg4 UTSW 18 20,598,181 (GRCm39) missense probably benign 0.00
R1392:Dsg4 UTSW 18 20,579,304 (GRCm39) splice site probably benign
R1442:Dsg4 UTSW 18 20,595,717 (GRCm39) missense possibly damaging 0.76
R1503:Dsg4 UTSW 18 20,582,736 (GRCm39) missense probably damaging 1.00
R1704:Dsg4 UTSW 18 20,604,646 (GRCm39) missense probably damaging 1.00
R1716:Dsg4 UTSW 18 20,595,518 (GRCm39) nonsense probably null
R1765:Dsg4 UTSW 18 20,589,888 (GRCm39) missense probably benign 0.01
R1817:Dsg4 UTSW 18 20,604,302 (GRCm39) missense probably damaging 1.00
R1982:Dsg4 UTSW 18 20,604,269 (GRCm39) missense probably damaging 1.00
R2097:Dsg4 UTSW 18 20,604,101 (GRCm39) missense probably damaging 1.00
R2198:Dsg4 UTSW 18 20,594,499 (GRCm39) missense probably benign
R3551:Dsg4 UTSW 18 20,584,813 (GRCm39) missense probably damaging 1.00
R3742:Dsg4 UTSW 18 20,604,058 (GRCm39) missense probably damaging 1.00
R3853:Dsg4 UTSW 18 20,582,291 (GRCm39) missense probably benign
R3955:Dsg4 UTSW 18 20,582,432 (GRCm39) splice site probably null
R4006:Dsg4 UTSW 18 20,604,022 (GRCm39) missense probably damaging 0.97
R4012:Dsg4 UTSW 18 20,584,919 (GRCm39) missense possibly damaging 0.81
R4171:Dsg4 UTSW 18 20,591,636 (GRCm39) nonsense probably null
R4254:Dsg4 UTSW 18 20,604,595 (GRCm39) missense probably benign 0.07
R4504:Dsg4 UTSW 18 20,594,493 (GRCm39) missense probably benign 0.00
R4559:Dsg4 UTSW 18 20,603,978 (GRCm39) missense probably damaging 1.00
R4607:Dsg4 UTSW 18 20,604,302 (GRCm39) missense probably damaging 1.00
R4612:Dsg4 UTSW 18 20,595,470 (GRCm39) missense probably benign 0.10
R4683:Dsg4 UTSW 18 20,594,466 (GRCm39) missense probably benign
R4700:Dsg4 UTSW 18 20,589,965 (GRCm39) missense possibly damaging 0.91
R4749:Dsg4 UTSW 18 20,579,888 (GRCm39) missense possibly damaging 0.88
R4775:Dsg4 UTSW 18 20,604,184 (GRCm39) missense possibly damaging 0.48
R4809:Dsg4 UTSW 18 20,599,678 (GRCm39) missense possibly damaging 0.82
R5276:Dsg4 UTSW 18 20,579,896 (GRCm39) missense probably benign 0.21
R5426:Dsg4 UTSW 18 20,591,541 (GRCm39) missense probably damaging 1.00
R5767:Dsg4 UTSW 18 20,595,549 (GRCm39) nonsense probably null
R5982:Dsg4 UTSW 18 20,598,226 (GRCm39) missense possibly damaging 0.76
R6280:Dsg4 UTSW 18 20,599,724 (GRCm39) missense probably damaging 1.00
R6305:Dsg4 UTSW 18 20,582,847 (GRCm39) missense probably damaging 1.00
R6489:Dsg4 UTSW 18 20,604,420 (GRCm39) missense possibly damaging 0.93
R7013:Dsg4 UTSW 18 20,591,578 (GRCm39) missense possibly damaging 0.58
R7040:Dsg4 UTSW 18 20,584,909 (GRCm39) missense probably benign 0.01
R7196:Dsg4 UTSW 18 20,599,537 (GRCm39) missense probably damaging 1.00
R7432:Dsg4 UTSW 18 20,579,323 (GRCm39) nonsense probably null
R7438:Dsg4 UTSW 18 20,599,685 (GRCm39) missense probably damaging 0.96
R7490:Dsg4 UTSW 18 20,584,993 (GRCm39) splice site probably null
R7612:Dsg4 UTSW 18 20,604,047 (GRCm39) missense probably damaging 1.00
R7639:Dsg4 UTSW 18 20,582,769 (GRCm39) missense probably damaging 1.00
R7905:Dsg4 UTSW 18 20,587,726 (GRCm39) missense probably damaging 1.00
R8251:Dsg4 UTSW 18 20,604,221 (GRCm39) missense probably damaging 1.00
R8326:Dsg4 UTSW 18 20,582,788 (GRCm39) missense probably benign 0.31
R8554:Dsg4 UTSW 18 20,586,100 (GRCm39) missense probably damaging 1.00
R8911:Dsg4 UTSW 18 20,584,929 (GRCm39) nonsense probably null
R9059:Dsg4 UTSW 18 20,604,182 (GRCm39) missense possibly damaging 0.62
R9508:Dsg4 UTSW 18 20,604,070 (GRCm39) missense probably damaging 1.00
R9607:Dsg4 UTSW 18 20,586,047 (GRCm39) missense probably benign 0.00
R9765:Dsg4 UTSW 18 20,604,334 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGGAAACACCCTGTCTTTCCAG -3'
(R):5'- TAGTAGTGAAATGTGAAACACTGC -3'

Sequencing Primer
(F):5'- GAAATCTACACCAATACTTACGCTGG -3'
(R):5'- TGTGAAACACTGCTATATATTGGC -3'
Posted On 2014-08-25