Mutagenetix > Incidental Mutations

Incidental Mutation 'R1985:Wdr7'

220559

Institutional Source

Beutler Lab

Gene Symbol

Wdr7

Ensembl Gene

ENSMUSG00000040560

Gene Name

WD repeat domain 7

Synonyms

TGF-beta resistance associated gene, TRAG

MMRRC Submission

039997-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.902) question?

Stock #

R1985 (G1)

Quality Score

217

Status

Validated

Chromosome

Chromosomal Location

63708695-63989760 bp(+) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

GTT to GT at 63760583 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000072509 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072726]

Predicted Effect

probably null
Transcript: ENSMUST00000072726

SMART Domains

Protein: ENSMUSP00000072509
Gene: ENSMUSG00000040560

Domain	Start	End	E-Value	Type
WD40	5	47	1.2e-2	SMART
WD40	53	95	3.71e-1	SMART
Blast:WD40	145	190	1e-18	BLAST
WD40	208	242	1.77e2	SMART
WD40	453	498	3.81e-5	SMART
WD40	501	546	4.26e1	SMART
WD40	549	588	1.63e-4	SMART
low complexity region	760	777	N/A	INTRINSIC
low complexity region	915	927	N/A	INTRINSIC
low complexity region	956	970	N/A	INTRINSIC
low complexity region	1020	1040	N/A	INTRINSIC
low complexity region	1181	1192	N/A	INTRINSIC
Blast:WD40	1341	1380	5e-20	BLAST
WD40	1382	1422	2.73e-6	SMART

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 94.2%

Validation Efficiency

94% (76/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD) that may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. The encoded protein forms the beta subunit of rabconnectin-3 and binds directly with Rab3A GDP/GTP exchange protein and indirectly with Rab3A GDP/GTP activating protein; these proteins are regulators of Rab3 small G protein family members involved in control of the calcium-dependant exocytosis of neurotransmitters. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1190007I07Rik	T	A	10: 82,620,217	T37S	possibly damaging	Het
AA792892	A	T	5: 94,384,072	I272L	probably benign	Het
Abhd8	C	A	8: 71,463,513		probably benign	Het
Adam5	A	T	8: 24,746,739	D648E	probably benign	Het
Akr1d1	A	G	6: 37,558,401	D240G	probably damaging	Het
Ankmy2	A	G	12: 36,157,364	H3R	possibly damaging	Het
Anpep	A	C	7: 79,840,857		probably null	Het
Apobr	A	G	7: 126,587,731	T20A	possibly damaging	Het
Atp2a2	A	T	5: 122,466,836	Y427N	probably benign	Het
Camkk2	A	C	5: 122,764,127	S40A	possibly damaging	Het
Camp	T	C	9: 109,848,429	N112S	probably benign	Het
Cbx7	A	G	15: 79,918,390	S229P	probably damaging	Het
Cnot2	T	C	10: 116,527,876	N41S	probably damaging	Het
Dchs1	A	G	7: 105,772,398	F272L	possibly damaging	Het
Dct	T	C	14: 118,036,542	K318E	probably benign	Het
Dhrs11	A	C	11: 84,828,807	L31V	probably damaging	Het
Dnah7a	T	C	1: 53,503,934	D2359G	probably benign	Het
Dnajc7	A	G	11: 100,590,892	S305P	probably benign	Het
Dscc1	CTGAATGAAT	CTGAAT	15: 55,080,176		probably benign	Het
Fam71b	T	C	11: 46,407,866	*666Q	probably null	Het
Flnc	A	G	6: 29,444,416		probably benign	Het
Gm7535	A	G	17: 17,911,538		probably benign	Het
Grtp1	A	G	8: 13,179,376	F313L	probably damaging	Het
Haus6	T	C	4: 86,593,609	Y425C	possibly damaging	Het
Hdac1	T	A	4: 129,528,960	N83Y	possibly damaging	Het
Hdlbp	A	G	1: 93,431,118	I237T	probably damaging	Het
Hfm1	A	T	5: 106,898,576	D481E	probably damaging	Het
Hipk3	T	C	2: 104,434,435	I737V	probably benign	Het
Il23r	T	A	6: 67,490,668		probably null	Het
Il24	G	A	1: 130,882,531	T196I	probably benign	Het
Ints3	C	T	3: 90,400,303		probably null	Het
Kcna6	T	C	6: 126,738,510	E472G	probably benign	Het
Kcnj16	C	T	11: 111,025,583	T357M	probably benign	Het
Kdm4b	T	A	17: 56,401,302	V957E	probably damaging	Het
Kif21b	G	A	1: 136,147,546	D166N	probably damaging	Het
Klhl11	G	T	11: 100,463,244	Q584K	probably benign	Het
Krt9	A	T	11: 100,189,991	M345K	probably benign	Het
Lgr5	T	C	10: 115,495,245		probably benign	Het
Lilr4b	A	T	10: 51,481,735	Q80L	possibly damaging	Het
Lrrc69	T	C	4: 14,708,669	E225G	possibly damaging	Het
Ly9	A	G	1: 171,599,773	S405P	probably damaging	Het
Myh2	A	G	11: 67,180,914	D519G	possibly damaging	Het
Nav3	G	A	10: 109,770,184		probably benign	Het
Nfkb1	G	A	3: 135,615,349	T215I	possibly damaging	Het
Ninj2	A	T	6: 120,198,639		probably benign	Het
Obsl1	A	G	1: 75,505,600	C209R	probably damaging	Het
Olfr1393	T	C	11: 49,280,283	I45T	probably damaging	Het
Olfr314	A	C	11: 58,786,384	D50A	probably damaging	Het
Olfr531	A	T	7: 140,400,800	M82K	possibly damaging	Het
Olfr539	G	A	7: 140,667,821	C171Y	probably damaging	Het
Olfr619	A	T	7: 103,603,672	Y6F	probably benign	Het
Olfr710	A	G	7: 106,944,926	I25T	probably benign	Het
Otud4	G	C	8: 79,640,012	R36P	probably damaging	Het
Pcnt	C	T	10: 76,380,337	R2239H	possibly damaging	Het
Pgbd5	T	A	8: 124,370,592	M491L	probably benign	Het
Pitrm1	A	T	13: 6,558,184	D316V	probably damaging	Het
Plod3	A	G	5: 136,990,853		probably null	Het
Plppr3	A	T	10: 79,867,460	Y63*	probably null	Het
Prickle2	T	C	6: 92,411,452	D323G	probably damaging	Het
Psmd11	A	T	11: 80,445,263	I114F	probably damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Rbp3	T	G	14: 33,956,461	S789A	probably benign	Het
Rbp3	C	T	14: 33,956,018	T641M	probably damaging	Het
Rfxap	C	A	3: 54,807,326	R117L	probably damaging	Het
Rims2	T	A	15: 39,345,314	M171K	probably damaging	Het
Scin	A	G	12: 40,133,908		probably null	Het
Scn11a	A	G	9: 119,754,678	S1624P	probably benign	Het
Slc41a3	G	A	6: 90,642,228	V330M	probably damaging	Het
Slc9c1	A	G	16: 45,550,106	I237V	probably benign	Het
Spag6	A	G	2: 18,732,119	I218V	probably benign	Het
Stam2	T	C	2: 52,709,626	T257A	possibly damaging	Het
Tbc1d24	G	A	17: 24,207,964	R318*	probably null	Het
Tedc2	C	A	17: 24,216,318	E366*	probably null	Het
Tedc2	T	A	17: 24,216,317	E366V	probably damaging	Het
Trpm3	T	A	19: 22,926,082	Y1069N	possibly damaging	Het
Tuba8	A	G	6: 121,220,520	D47G	probably benign	Het
Tulp3	A	T	6: 128,326,806	S277T	probably benign	Het
Ybx2	A	G	11: 69,936,468		probably null	Het
Zfp407	C	T	18: 84,559,773	A1072T	probably benign	Het
Zfp788	T	A	7: 41,650,481	I795N	probably damaging	Het

Other mutations in Wdr7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00513:Wdr7	APN	18	63720775	missense	possibly damaging	0.83
IGL00708:Wdr7	APN	18	63778033	missense	probably benign	0.42
IGL00813:Wdr7	APN	18	63735604	missense	possibly damaging	0.84
IGL00840:Wdr7	APN	18	63927327	missense	possibly damaging	0.80
IGL00904:Wdr7	APN	18	63796231	missense	probably benign	0.43
IGL00930:Wdr7	APN	18	63740244	nonsense	probably null
IGL01481:Wdr7	APN	18	63739179	missense	probably damaging	1.00
IGL02121:Wdr7	APN	18	63777545	nonsense	probably null
IGL02346:Wdr7	APN	18	63865336	missense	probably benign	0.09
IGL02454:Wdr7	APN	18	63796228	missense	probably benign	0.20
IGL02538:Wdr7	APN	18	63796235	missense	probably benign	0.01
IGL02870:Wdr7	APN	18	63791843	missense	probably benign
IGL03054:Wdr7	APN	18	63825121	splice site	probably benign
IGL03189:Wdr7	APN	18	63760601	missense	probably benign	0.17
R0014:Wdr7	UTSW	18	63904101	missense	probably benign	0.03
R0022:Wdr7	UTSW	18	63777634	missense	probably damaging	1.00
R0233:Wdr7	UTSW	18	63904101	missense	probably benign	0.03
R0432:Wdr7	UTSW	18	63796249	missense	probably damaging	0.96
R0496:Wdr7	UTSW	18	63791843	missense	probably benign
R0633:Wdr7	UTSW	18	63865300	missense	probably benign	0.00
R0931:Wdr7	UTSW	18	63865300	missense	probably benign	0.00
R1585:Wdr7	UTSW	18	63924918	missense	probably benign	0.03
R1651:Wdr7	UTSW	18	63720776	nonsense	probably null
R1804:Wdr7	UTSW	18	63865440	missense	probably damaging	1.00
R1874:Wdr7	UTSW	18	63728504	missense	probably benign	0.02
R2106:Wdr7	UTSW	18	63778038	missense	probably damaging	1.00
R2206:Wdr7	UTSW	18	63777607	missense	possibly damaging	0.95
R2207:Wdr7	UTSW	18	63777607	missense	possibly damaging	0.95
R2245:Wdr7	UTSW	18	63924909	missense	possibly damaging	0.60
R2407:Wdr7	UTSW	18	63760723	missense	probably benign
R3804:Wdr7	UTSW	18	63720836	missense	probably benign
R3880:Wdr7	UTSW	18	63724155	missense	possibly damaging	0.92
R4410:Wdr7	UTSW	18	63778249	missense	probably damaging	1.00
R4441:Wdr7	UTSW	18	63755210	missense	probably damaging	1.00
R4485:Wdr7	UTSW	18	63777550	missense	possibly damaging	0.89
R4606:Wdr7	UTSW	18	63779945	nonsense	probably null
R4607:Wdr7	UTSW	18	63777580	missense	probably benign	0.28
R4608:Wdr7	UTSW	18	63777580	missense	probably benign	0.28
R4711:Wdr7	UTSW	18	63728465	missense	probably benign
R4852:Wdr7	UTSW	18	63777949	missense	probably damaging	0.98
R5197:Wdr7	UTSW	18	63738866	missense	probably benign	0.02
R5213:Wdr7	UTSW	18	63755126	missense	probably damaging	1.00
R5280:Wdr7	UTSW	18	63987312	missense	probably benign	0.35
R5378:Wdr7	UTSW	18	63825239	critical splice donor site	probably null
R6076:Wdr7	UTSW	18	63739277	missense	probably damaging	1.00
R6083:Wdr7	UTSW	18	63728469	missense	probably damaging	1.00
R6168:Wdr7	UTSW	18	63777977	missense	probably damaging	0.98
R6234:Wdr7	UTSW	18	63724132	missense	probably damaging	1.00
R6295:Wdr7	UTSW	18	63755111	missense	probably damaging	1.00
R6548:Wdr7	UTSW	18	63778251	missense	possibly damaging	0.87
R6566:Wdr7	UTSW	18	63755055	missense	possibly damaging	0.72
R6696:Wdr7	UTSW	18	63739330	missense	probably benign	0.07
R6937:Wdr7	UTSW	18	63791867	missense	probably benign
R6962:Wdr7	UTSW	18	63865288	missense	possibly damaging	0.74
R7162:Wdr7	UTSW	18	63724139	missense	possibly damaging	0.92
R7376:Wdr7	UTSW	18	63777620	missense	probably damaging	1.00
R7423:Wdr7	UTSW	18	63777380	splice site	probably null
R7781:Wdr7	UTSW	18	63777789	nonsense	probably null
R7851:Wdr7	UTSW	18	63720327	missense	probably benign	0.05
R7962:Wdr7	UTSW	18	63904086	missense	probably damaging	1.00
R8310:Wdr7	UTSW	18	63735685	missense	probably damaging	0.98
R8325:Wdr7	UTSW	18	63778464	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- TACTGGGAAGGTTTGTGAAGAC -3'
(R):5'- CAAAAGGTTCGTTGCAAGGG -3'

Sequencing Primer
(F):5'- ATTGTGGGATCTACATGGAAGATTAG -3'
(R):5'- CAAGGGTTTGCAGCTTATGG -3'

Posted On

2014-08-25