Mutagenetix > Incidental Mutation

Incidental Mutation 'R1986:Kif21b'

220572

Institutional Source

Beutler Lab

Gene Symbol

Kif21b

Ensembl Gene

ENSMUSG00000041642

Gene Name

kinesin family member 21B

Synonyms

N-5 kinesin, 2610511N21Rik

MMRRC Submission

039998-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.116) question?

Stock #

R1986 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

136131389-136177998 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 136147546 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 166 (D166N)

Ref Sequence

ENSEMBL: ENSMUSP00000074661 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075164] [ENSMUST00000130864]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000075164
AA Change: D166N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000074661
Gene: ENSMUSG00000041642
AA Change: D166N

Domain	Start	End	E-Value	Type
KISc	6	379	6.39e-159	SMART
Blast:KISc	469	543	1e-14	BLAST
low complexity region	578	628	N/A	INTRINSIC
coiled coil region	632	825	N/A	INTRINSIC
low complexity region	847	866	N/A	INTRINSIC
coiled coil region	931	991	N/A	INTRINSIC
low complexity region	1109	1123	N/A	INTRINSIC
low complexity region	1239	1249	N/A	INTRINSIC
low complexity region	1266	1279	N/A	INTRINSIC
WD40	1299	1336	2.89e-5	SMART
WD40	1339	1377	5.69e-4	SMART
WD40	1404	1441	6.42e-1	SMART
WD40	1444	1486	1.5e-3	SMART
WD40	1494	1532	4.8e-2	SMART
WD40	1535	1575	1.55e-5	SMART
WD40	1578	1615	3.81e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122892

Predicted Effect

probably damaging
Transcript: ENSMUST00000130864
AA Change: D166N

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000114297
Gene: ENSMUSG00000041642
AA Change: D166N

Domain	Start	End	E-Value	Type
KISc	6	379	6.39e-159	SMART
Blast:KISc	469	543	1e-14	BLAST
low complexity region	578	628	N/A	INTRINSIC
coiled coil region	632	825	N/A	INTRINSIC
low complexity region	847	866	N/A	INTRINSIC
coiled coil region	931	991	N/A	INTRINSIC
low complexity region	1109	1123	N/A	INTRINSIC
low complexity region	1239	1249	N/A	INTRINSIC
low complexity region	1266	1279	N/A	INTRINSIC
WD40	1299	1336	2.89e-5	SMART
WD40	1339	1377	5.69e-4	SMART
WD40	1404	1441	6.42e-1	SMART
WD40	1444	1486	1.5e-3	SMART
WD40	1494	1532	4.8e-2	SMART
WD40	1535	1575	1.55e-5	SMART
WD40	1578	1615	5.1e-6	SMART

Meta Mutation Damage Score

0.2816

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin superfamily. Kinesins are ATP-dependent microtubule-based motor proteins that are involved in the intracellular transport of membranous organelles. Single nucleotide polymorphisms in this gene are associated with inflammatory bowel disease and multiple sclerosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous KO reduces dendrite branching and spine density as a result of reduced microtubule growth, resulting in impaired spatial learning and cued conditioning behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	G	3: 124,419,328	S105P	probably damaging	Het
2610507B11Rik	A	T	11: 78,274,612	H1318L	probably damaging	Het
9930111J21Rik2	T	A	11: 49,019,292	K771N	possibly damaging	Het
Abcc2	A	G	19: 43,829,879	E1268G	probably damaging	Het
Adamts4	T	C	1: 171,256,675	F574L	possibly damaging	Het
Adamts9	A	G	6: 92,796,394	V1165A	probably benign	Het
Agap2	A	T	10: 127,083,044	K430*	probably null	Het
Amn	G	T	12: 111,274,997	G232V	probably damaging	Het
Ank3	A	G	10: 69,867,428	E297G	probably damaging	Het
Arhgap45	T	C	10: 80,020,696	L26P	probably damaging	Het
Atp10b	C	A	11: 43,172,768	Q177K	probably benign	Het
Bbs10	A	T	10: 111,299,257	D77V	probably damaging	Het
Bpifa1	T	A	2: 154,144,336	L127Q	probably damaging	Het
Brinp2	T	C	1: 158,246,778	N591S	probably damaging	Het
C2cd2	A	C	16: 97,870,271	V476G	probably damaging	Het
C7	T	A	15: 5,012,012	T471S	possibly damaging	Het
Cacna1b	A	T	2: 24,648,986	Y1488N	probably damaging	Het
Cadps2	A	G	6: 23,323,380	F1001L	probably damaging	Het
Ccdc188	T	C	16: 18,218,843	S216P	probably damaging	Het
Ccdc24	A	G	4: 117,872,016	L88P	probably damaging	Het
Dab1	T	C	4: 104,613,215	I65T	probably damaging	Het
Dock4	A	T	12: 40,730,063	D621V	probably damaging	Het
Drd5	A	T	5: 38,320,113	M150L	probably damaging	Het
Eef2k	T	A	7: 120,873,346	M94K	possibly damaging	Het
Epg5	A	G	18: 77,982,306		probably null	Het
Epsti1	T	C	14: 77,932,233		probably null	Het
Ern2	T	A	7: 122,171,529	D754V	probably benign	Het
Fam129c	T	A	8: 71,603,760	I368N	possibly damaging	Het
Fbxo6	A	G	4: 148,146,095	Y237H	probably damaging	Het
Fbxw24	A	G	9: 109,607,056	S303P	probably damaging	Het
Fpr-rs3	A	T	17: 20,623,841		probably null	Het
Gab1	G	T	8: 80,766,381	T679K	probably damaging	Het
Gbp9	C	A	5: 105,105,724	V42F	probably damaging	Het
Gbp9	A	T	5: 105,105,786	V21E	probably damaging	Het
Gm14085	A	G	2: 122,527,429	T655A	probably benign	Het
Gm20821	A	G	Y: 9,783,927	Q183R	probably benign	Het
Gpatch11	A	T	17: 78,843,837	I226F	probably benign	Het
Hephl1	T	G	9: 15,054,552	E1035A	probably damaging	Het
Hspa4l	T	C	3: 40,760,401	V156A	probably damaging	Het
Ifna13	A	G	4: 88,644,351	V12A	probably benign	Het
Il24	G	A	1: 130,882,531	T196I	probably benign	Het
Irgm2	A	G	11: 58,219,558	D37G	probably benign	Het
Irs1	A	G	1: 82,288,765	S577P	probably damaging	Het
Krtap4-16	T	C	11: 99,851,496	Q26R	unknown	Het
Lig1	T	A	7: 13,309,142	Y837*	probably null	Het
Lrrc69	T	C	4: 14,708,669	E225G	possibly damaging	Het
Map3k20	C	T	2: 72,441,294	Q589*	probably null	Het
Masp1	T	G	16: 23,483,461	M347L	probably benign	Het
Mgat3	A	T	15: 80,212,189	I406F	probably benign	Het
Mmp1b	T	G	9: 7,368,577	D425A	probably benign	Het
Mss51	T	C	14: 20,483,191	H404R	probably benign	Het
Myo15b	A	T	11: 115,882,875	H1911L	probably benign	Het
Nedd4l	A	G	18: 65,143,803	D102G	probably damaging	Het
Npc2	T	C	12: 84,760,749	K112E	probably benign	Het
Nuggc	T	A	14: 65,641,921	V694E	probably damaging	Het
Olfm1	T	G	2: 28,214,706	V157G	probably benign	Het
Olfr476	T	C	7: 107,967,670	V91A	probably benign	Het
Olfr63	T	C	17: 33,269,515	S264P	probably benign	Het
Otogl	T	A	10: 107,794,190		probably null	Het
Ovgp1	G	A	3: 105,974,935	C38Y	probably damaging	Het
Pisd	A	T	5: 32,737,328	S344T	probably damaging	Het
Psme4	T	C	11: 30,830,352	V840A	probably benign	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Rims2	T	A	15: 39,345,314	M171K	probably damaging	Het
Rin2	T	A	2: 145,878,940	M731K	probably damaging	Het
Scgb1b19	T	C	7: 33,287,683		probably null	Het
Serpina10	A	G	12: 103,628,255	I235T	possibly damaging	Het
Setbp1	T	A	18: 78,858,544	E636V	probably damaging	Het
Sh3d21	C	T	4: 126,162,497	E101K	probably damaging	Het
Ski	T	G	4: 155,221,691	D225A	probably damaging	Het
Slc29a3	T	C	10: 60,723,814	Y187C	probably damaging	Het
Sort1	T	A	3: 108,345,727	D494E	possibly damaging	Het
Sphkap	A	T	1: 83,277,922	L702Q	probably damaging	Het
Srr	A	G	11: 74,908,719	I285T	probably damaging	Het
Stam2	T	C	2: 52,709,626	T257A	possibly damaging	Het
Suds3	A	T	5: 117,108,352	N112K	probably damaging	Het
Tedc2	T	A	17: 24,216,317	E366V	probably damaging	Het
Tedc2	C	A	17: 24,216,318	E366*	probably null	Het
Tesk2	T	C	4: 116,751,193	L104P	probably damaging	Het
Tie1	C	T	4: 118,478,963	R702H	probably benign	Het
Tpo	G	T	12: 30,119,466	A90E	probably damaging	Het
Trim30a	T	C	7: 104,411,465	D368G	probably damaging	Het
Ugt2a2	A	T	5: 87,460,579	M633K	possibly damaging	Het
Vars2	A	G	17: 35,660,061	W626R	probably damaging	Het
Vmn2r10	A	T	5: 109,006,254	Y61*	probably null	Het
Vmn2r95	T	C	17: 18,451,543	V514A	probably benign	Het
Vwa5a	T	G	9: 38,737,814		probably benign	Het
Zfp365	A	T	10: 67,909,856	C31S	probably damaging	Het
Zfp397	A	T	18: 23,960,051	I198F	possibly damaging	Het
Zfp407	C	T	18: 84,559,773	A1072T	probably benign	Het
Zfp593	T	C	4: 134,244,895	E100G	possibly damaging	Het

Other mutations in Kif21b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Kif21b	APN	1	136152342	missense	possibly damaging	0.68
IGL01020:Kif21b	APN	1	136154094	splice site	probably benign
IGL01288:Kif21b	APN	1	136172184	missense	probably benign	0.00
IGL02105:Kif21b	APN	1	136171303	missense	probably benign
IGL02264:Kif21b	APN	1	136159757	missense	probably damaging	1.00
IGL02303:Kif21b	APN	1	136159757	missense	probably damaging	1.00
IGL02308:Kif21b	APN	1	136159757	missense	probably damaging	1.00
IGL02310:Kif21b	APN	1	136159757	missense	probably damaging	1.00
IGL02419:Kif21b	APN	1	136151267	missense	probably benign	0.00
IGL02553:Kif21b	APN	1	136154121	missense	probably damaging	1.00
IGL02568:Kif21b	APN	1	136172867	missense	probably damaging	0.96
IGL02657:Kif21b	APN	1	136172230	missense	possibly damaging	0.88
IGL03068:Kif21b	APN	1	136158355	unclassified	probably benign
IGL03230:Kif21b	APN	1	136162812	missense	probably benign	0.03
R0629_Kif21b_729	UTSW	1	136172157	critical splice acceptor site	probably null
Schiessen	UTSW	1	136147869	critical splice donor site	probably null
wolfen	UTSW	1	136144758	nonsense	probably null
R0190:Kif21b	UTSW	1	136171219	missense	probably benign	0.32
R0349:Kif21b	UTSW	1	136149311	missense	probably damaging	0.97
R0501:Kif21b	UTSW	1	136163099	missense	probably benign	0.44
R0620:Kif21b	UTSW	1	136159428	missense	possibly damaging	0.88
R0629:Kif21b	UTSW	1	136172157	critical splice acceptor site	probably null
R0741:Kif21b	UTSW	1	136159744	missense	probably damaging	1.00
R1087:Kif21b	UTSW	1	136162823	missense	probably damaging	1.00
R1217:Kif21b	UTSW	1	136152376	missense	probably damaging	1.00
R1464:Kif21b	UTSW	1	136156153	missense	possibly damaging	0.50
R1464:Kif21b	UTSW	1	136156153	missense	possibly damaging	0.50
R1511:Kif21b	UTSW	1	136169324	critical splice donor site	probably null
R1512:Kif21b	UTSW	1	136152805	missense	probably benign	0.01
R1513:Kif21b	UTSW	1	136156111	missense	probably damaging	0.98
R1591:Kif21b	UTSW	1	136149317	missense	probably damaging	1.00
R1616:Kif21b	UTSW	1	136171685	missense	probably damaging	1.00
R1628:Kif21b	UTSW	1	136171220	missense	probably benign	0.01
R1658:Kif21b	UTSW	1	136171285	missense	probably damaging	1.00
R1728:Kif21b	UTSW	1	136160121	missense	possibly damaging	0.85
R1741:Kif21b	UTSW	1	136156142	missense	probably damaging	1.00
R1784:Kif21b	UTSW	1	136160121	missense	possibly damaging	0.85
R1807:Kif21b	UTSW	1	136147793	missense	possibly damaging	0.94
R1896:Kif21b	UTSW	1	136147845	missense	possibly damaging	0.90
R1970:Kif21b	UTSW	1	136171156	missense	probably damaging	1.00
R1984:Kif21b	UTSW	1	136147546	missense	probably damaging	1.00
R1985:Kif21b	UTSW	1	136147546	missense	probably damaging	1.00
R1988:Kif21b	UTSW	1	136152264	missense	probably damaging	0.98
R1990:Kif21b	UTSW	1	136161770	missense	probably damaging	1.00
R2014:Kif21b	UTSW	1	136148282	missense	probably damaging	1.00
R2045:Kif21b	UTSW	1	136160313	missense	probably damaging	1.00
R2141:Kif21b	UTSW	1	136152264	missense	probably damaging	0.98
R2248:Kif21b	UTSW	1	136172966	missense	probably damaging	1.00
R2886:Kif21b	UTSW	1	136147874	splice site	probably benign
R2896:Kif21b	UTSW	1	136154217	missense	possibly damaging	0.82
R3706:Kif21b	UTSW	1	136159410	missense	probably benign	0.06
R3780:Kif21b	UTSW	1	136156226	missense	probably damaging	0.99
R3827:Kif21b	UTSW	1	136162994	critical splice donor site	probably null
R4227:Kif21b	UTSW	1	136154093	splice site	probably null
R4600:Kif21b	UTSW	1	136147864	missense	probably benign	0.39
R4608:Kif21b	UTSW	1	136148186	intron	probably benign
R4749:Kif21b	UTSW	1	136144749	nonsense	probably null
R4841:Kif21b	UTSW	1	136145220	missense	probably damaging	1.00
R4842:Kif21b	UTSW	1	136145220	missense	probably damaging	1.00
R4933:Kif21b	UTSW	1	136151325	splice site	probably null
R4959:Kif21b	UTSW	1	136148370	missense	possibly damaging	0.90
R5018:Kif21b	UTSW	1	136172234	missense	probably benign	0.30
R5116:Kif21b	UTSW	1	136152783	missense	probably damaging	0.99
R5119:Kif21b	UTSW	1	136163100	missense	probably benign
R5197:Kif21b	UTSW	1	136144625	missense	probably damaging	1.00
R5230:Kif21b	UTSW	1	136171673	missense	probably damaging	1.00
R5249:Kif21b	UTSW	1	136169228	missense	probably damaging	1.00
R5337:Kif21b	UTSW	1	136171143	missense	probably damaging	1.00
R5358:Kif21b	UTSW	1	136172292	missense	possibly damaging	0.85
R5466:Kif21b	UTSW	1	136147525	missense	probably damaging	1.00
R5557:Kif21b	UTSW	1	136170059	missense	probably damaging	1.00
R5727:Kif21b	UTSW	1	136170009	missense	probably damaging	1.00
R5865:Kif21b	UTSW	1	136151137	nonsense	probably null
R5929:Kif21b	UTSW	1	136151207	missense	probably damaging	1.00
R6274:Kif21b	UTSW	1	136149418	missense	possibly damaging	0.57
R6349:Kif21b	UTSW	1	136158326	missense	probably damaging	1.00
R6648:Kif21b	UTSW	1	136152397	missense	probably benign	0.00
R6831:Kif21b	UTSW	1	136144758	nonsense	probably null
R7156:Kif21b	UTSW	1	136147824	missense	probably damaging	1.00
R7165:Kif21b	UTSW	1	136149448	missense	probably damaging	0.98
R7327:Kif21b	UTSW	1	136159649	missense	possibly damaging	0.60
R7680:Kif21b	UTSW	1	136147869	critical splice donor site	probably null
R7975:Kif21b	UTSW	1	136171173	missense	probably damaging	1.00
R8356:Kif21b	UTSW	1	136172945	missense	probably damaging	1.00
R8467:Kif21b	UTSW	1	136172283	missense	probably damaging	0.98
R9031:Kif21b	UTSW	1	136145304	missense	probably damaging	0.99
R9101:Kif21b	UTSW	1	136151155	missense	probably damaging	0.96
R9191:Kif21b	UTSW	1	136172821	nonsense	probably null
R9261:Kif21b	UTSW	1	136149424	missense	probably damaging	1.00
R9280:Kif21b	UTSW	1	136171707	critical splice donor site	probably null
R9307:Kif21b	UTSW	1	136174062	missense	probably benign
R9562:Kif21b	UTSW	1	136149352	missense	probably damaging	0.99
R9563:Kif21b	UTSW	1	136149428	missense	probably damaging	1.00
R9565:Kif21b	UTSW	1	136149352	missense	probably damaging	0.99
R9758:Kif21b	UTSW	1	136153223	missense	probably damaging	1.00
R9760:Kif21b	UTSW	1	136148683	missense	probably damaging	1.00
RF024:Kif21b	UTSW	1	136158341	missense	probably damaging	1.00
X0053:Kif21b	UTSW	1	136149316	missense	probably damaging	1.00
X0066:Kif21b	UTSW	1	136172945	missense	probably damaging	1.00
Z1176:Kif21b	UTSW	1	136154137	missense	probably benign	0.00
Z1177:Kif21b	UTSW	1	136148312	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GATAGCACTGCTTGGAGGAC -3'
(R):5'- TACATTCATCTGGGTGCTGGC -3'

Sequencing Primer
(F):5'- CCAGGGTTCAGCAAGTTAAATTG -3'
(R):5'- AGGCACTGGATCAGCTGG -3'

Posted On

2014-08-25