Incidental Mutation 'R2026:Hif3a'
ID220611
Institutional Source Beutler Lab
Gene Symbol Hif3a
Ensembl Gene ENSMUSG00000004328
Gene Namehypoxia inducible factor 3, alpha subunit
SynonymsMOP7, Nepas, bHLHe17
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.364) question?
Stock #R2026 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location17031507-17062427 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17044397 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 437 (R437G)
Ref Sequence ENSEMBL: ENSMUSP00000104132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037762] [ENSMUST00000108492]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037762
AA Change: R435G

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000048248
Gene: ENSMUSG00000004328
AA Change: R435G

DomainStartEndE-ValueType
HLH 18 73 1.57e-7 SMART
PAS 82 148 9.83e-10 SMART
PAS 225 293 2.72e-3 SMART
PAC 299 342 2.18e-2 SMART
low complexity region 421 437 N/A INTRINSIC
Pfam:HIF-1 472 505 1.8e-18 PFAM
low complexity region 508 520 N/A INTRINSIC
low complexity region 525 536 N/A INTRINSIC
low complexity region 595 607 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108492
AA Change: R437G

PolyPhen 2 Score 0.806 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104132
Gene: ENSMUSG00000004328
AA Change: R437G

DomainStartEndE-ValueType
HLH 20 75 1.57e-7 SMART
PAS 84 150 9.83e-10 SMART
PAS 227 295 2.72e-3 SMART
PAC 301 344 2.18e-2 SMART
low complexity region 423 439 N/A INTRINSIC
Pfam:HIF-1 475 506 5.7e-18 PFAM
low complexity region 510 522 N/A INTRINSIC
low complexity region 527 538 N/A INTRINSIC
low complexity region 597 609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139224
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the alpha-3 subunit of one of several alpha/beta-subunit heterodimeric transcription factors that regulate many adaptive responses to low oxygen tension (hypoxia). The alpha-3 subunit lacks the transactivation domain found in factors containing either the alpha-1 or alpha-2 subunits. It is thought that factors containing the alpha-3 subunit are negative regulators of hypoxia-inducible gene expression. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired lung remodeling resulting in hypertrophy of the heart right ventricle and pulmonary hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik A G 8: 120,153,466 K269R probably benign Het
Abcc12 A G 8: 86,558,233 V251A probably benign Het
Avil G A 10: 127,011,873 G556S probably damaging Het
C3 T C 17: 57,218,562 Y898C probably damaging Het
Cacng2 A G 15: 77,995,520 F201L possibly damaging Het
Casp7 T A 19: 56,436,398 I183N probably damaging Het
Cntn3 A T 6: 102,420,427 W62R probably damaging Het
Ctrb1 T C 8: 111,688,685 N119S probably benign Het
Cyp3a59 G A 5: 146,096,288 V157M probably damaging Het
Dhfr G T 13: 92,365,771 G117* probably null Het
Dido1 A T 2: 180,689,181 L158* probably null Het
Dlg2 C A 7: 91,965,723 P290Q probably damaging Het
Dnah3 T A 7: 120,039,406 Q1240L probably damaging Het
Exd1 A T 2: 119,520,305 S492T probably benign Het
Fermt1 T C 2: 132,918,525 I415M probably benign Het
Fsip2 A G 2: 82,989,444 T5174A possibly damaging Het
Fuca2 T G 10: 13,512,647 V389G probably damaging Het
Gm14412 A T 2: 177,317,105 H50Q possibly damaging Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm5129 G A 5: 29,735,734 probably benign Het
Hook3 T C 8: 26,038,098 E588G probably damaging Het
Hs1bp3 A G 12: 8,337,738 E301G probably benign Het
Icam2 A G 11: 106,382,442 F15L probably benign Het
Ice2 T C 9: 69,416,325 S701P probably benign Het
Igf2bp1 A G 11: 95,974,170 V151A possibly damaging Het
Lig4 A T 8: 9,972,436 L448Q probably damaging Het
Man2b1 G C 8: 85,095,335 W726C probably damaging Het
Mepe T C 5: 104,327,091 S13P possibly damaging Het
Msh6 C T 17: 87,990,343 H1264Y probably damaging Het
Ncoa1 A T 12: 4,267,647 S1228R probably benign Het
Ndufa10 A G 1: 92,439,892 Y339H probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Nutm2 A G 13: 50,474,820 H640R probably benign Het
Olfr1133 G T 2: 87,645,409 A238E probably damaging Het
Olfr1487 T A 19: 13,619,581 C140S probably damaging Het
Olfr266 T C 3: 106,821,711 I283V probably benign Het
Olfr31 T C 14: 14,328,891 V260A probably benign Het
Olfr616 T A 7: 103,564,877 Y134F probably damaging Het
Olfr801 T A 10: 129,670,465 D18V probably damaging Het
Pde1c C T 6: 56,180,190 V162I probably damaging Het
Pdss2 A T 10: 43,393,875 N238I possibly damaging Het
Pfas C T 11: 68,993,957 G473E probably damaging Het
Pkn1 A G 8: 83,671,378 V795A probably damaging Het
Polq A G 16: 37,062,745 D1757G possibly damaging Het
Popdc3 T C 10: 45,314,855 W21R probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rfc1 G T 5: 65,288,029 T412K probably damaging Het
Sap130 T C 18: 31,698,574 S706P possibly damaging Het
Scgn T C 13: 23,991,064 probably benign Het
Smad7 T C 18: 75,394,154 V357A probably damaging Het
Snrnp48 G T 13: 38,209,886 A56S possibly damaging Het
Sptbn1 G T 11: 30,104,559 A2178E probably benign Het
Syn2 C T 6: 115,278,251 T508I probably benign Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmtc4 T C 14: 122,921,265 N682S probably benign Het
Trpm7 T C 2: 126,812,738 K1427E probably benign Het
Trrap A G 5: 144,803,044 I1118V possibly damaging Het
Tslp A T 18: 32,815,672 I37L probably benign Het
Ttll3 G A 6: 113,398,770 V297M probably damaging Het
Ttn T C 2: 76,710,369 D34091G possibly damaging Het
Txndc11 CCCGCCGCCGCCGCCGC CCCGCCGCCGCCGC 16: 11,134,474 probably benign Het
Ube3a T C 7: 59,303,726 F803L probably damaging Het
Ubn1 A G 16: 5,064,650 E325G probably damaging Het
Wfikkn2 A G 11: 94,238,953 W121R possibly damaging Het
Zfp579 C A 7: 4,993,521 E464* probably null Het
Zfp616 A T 11: 74,083,587 L227F possibly damaging Het
Other mutations in Hif3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Hif3a APN 7 17051916 splice site probably null
IGL02496:Hif3a APN 7 17039678 splice site probably benign
IGL02572:Hif3a APN 7 17050588 missense probably null
IGL02638:Hif3a APN 7 17044368 unclassified probably benign
IGL02704:Hif3a APN 7 17050761 unclassified probably benign
IGL03000:Hif3a APN 7 17048639 missense probably benign 0.08
IGL03342:Hif3a APN 7 17041122 missense possibly damaging 0.92
R0265:Hif3a UTSW 7 17035868 makesense probably null
R0326:Hif3a UTSW 7 17044400 missense probably benign 0.01
R0396:Hif3a UTSW 7 17052021 splice site probably benign
R1494:Hif3a UTSW 7 17054722 missense probably damaging 1.00
R1529:Hif3a UTSW 7 17042639 missense probably benign 0.02
R1548:Hif3a UTSW 7 17044403 missense probably benign 0.00
R1686:Hif3a UTSW 7 17044864 missense possibly damaging 0.46
R1916:Hif3a UTSW 7 17039656 missense possibly damaging 0.87
R2032:Hif3a UTSW 7 17051179 missense probably damaging 1.00
R2354:Hif3a UTSW 7 17041105 missense probably damaging 1.00
R3693:Hif3a UTSW 7 17041074 missense probably damaging 1.00
R3780:Hif3a UTSW 7 17054713 missense probably damaging 1.00
R3921:Hif3a UTSW 7 17037172 missense possibly damaging 0.80
R4003:Hif3a UTSW 7 17044919 missense probably damaging 0.99
R4714:Hif3a UTSW 7 17056271 missense probably damaging 1.00
R4953:Hif3a UTSW 7 17050565 missense probably damaging 0.98
R5632:Hif3a UTSW 7 17050655 missense possibly damaging 0.94
R5778:Hif3a UTSW 7 17051984 missense probably damaging 1.00
R5877:Hif3a UTSW 7 17051146 missense probably damaging 1.00
R5995:Hif3a UTSW 7 17053769 missense probably benign 0.10
R6001:Hif3a UTSW 7 17050561 missense probably damaging 1.00
R6599:Hif3a UTSW 7 17042605 missense possibly damaging 0.68
R7218:Hif3a UTSW 7 17050588 missense probably damaging 1.00
R7478:Hif3a UTSW 7 17042635 missense possibly damaging 0.47
R7479:Hif3a UTSW 7 17042635 missense possibly damaging 0.47
R7480:Hif3a UTSW 7 17042635 missense possibly damaging 0.47
R7482:Hif3a UTSW 7 17042635 missense possibly damaging 0.47
R7654:Hif3a UTSW 7 17049096 missense probably damaging 0.97
R7696:Hif3a UTSW 7 17054787 missense unknown
Predicted Primers PCR Primer
(F):5'- CAAGTACTGGGATCACAGGTG -3'
(R):5'- GCCTTCAGCCTTGGGTAACTAG -3'

Sequencing Primer
(F):5'- ATAGCAAGGCTCAAGCCA -3'
(R):5'- GGGTAACTAGGTTCTGTTCACCC -3'
Posted On2014-08-25