Incidental Mutation 'R1986:Tie1'
ID 220614
Institutional Source Beutler Lab
Gene Symbol Tie1
Ensembl Gene ENSMUSG00000033191
Gene Name tyrosine kinase with immunoglobulin-like and EGF-like domains 1
Synonyms D430008P04Rik, tie-1, TIE
MMRRC Submission 039998-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1986 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 118328388-118347046 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 118336160 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 702 (R702H)
Ref Sequence ENSEMBL: ENSMUSP00000037129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047421] [ENSMUST00000184261]
AlphaFold Q06806
Predicted Effect probably benign
Transcript: ENSMUST00000047421
AA Change: R702H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037129
Gene: ENSMUSG00000033191
AA Change: R702H

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 129 211 1.58e-1 SMART
EGF 221 254 1.47e-3 SMART
EGF_like 265 301 7.23e1 SMART
EGF 312 343 8.52e0 SMART
IG 355 442 1.92e0 SMART
FN3 445 528 2.68e-2 SMART
FN3 544 627 4.1e0 SMART
FN3 640 722 6.95e-10 SMART
transmembrane domain 760 782 N/A INTRINSIC
TyrKc 835 1103 5.05e-134 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153286
Predicted Effect probably benign
Transcript: ENSMUST00000184261
SMART Domains Protein: ENSMUSP00000139279
Gene: ENSMUSG00000033191

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 129 211 1.58e-1 SMART
EGF 221 254 1.47e-3 SMART
EGF_like 265 301 7.23e1 SMART
EGF 312 343 8.52e0 SMART
IG 355 442 1.92e0 SMART
FN3 445 528 2.68e-2 SMART
FN3 544 627 4.1e0 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tyrosine protein kinase family. The encoded protein plays a critical role in angiogenesis and blood vessel stability by inhibiting angiopoietin 1 signaling through the endothelial receptor tyrosine kinase Tie2. Ectodomain cleavage of the encoded protein relieves inhibition of Tie2 and is mediated by multiple factors including vascular endothelial growth factor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutation of this gene results in embryonic or neonatal lethality, hemorrhages, edema, increased vascular branching, and abnormal vascular endothelial cell development. Mice homozygous for a hypomorphic allele exhibit dilated and disorganized lymphatic vessel, edema, and hemorrhage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,212,977 (GRCm39) S105P probably damaging Het
9930111J21Rik2 T A 11: 48,910,119 (GRCm39) K771N possibly damaging Het
Abcc2 A G 19: 43,818,318 (GRCm39) E1268G probably damaging Het
Adamts4 T C 1: 171,084,244 (GRCm39) F574L possibly damaging Het
Adamts9 A G 6: 92,773,375 (GRCm39) V1165A probably benign Het
Agap2 A T 10: 126,918,913 (GRCm39) K430* probably null Het
Amn G T 12: 111,241,431 (GRCm39) G232V probably damaging Het
Ank3 A G 10: 69,703,258 (GRCm39) E297G probably damaging Het
Arhgap45 T C 10: 79,856,530 (GRCm39) L26P probably damaging Het
Atp10b C A 11: 43,063,595 (GRCm39) Q177K probably benign Het
Bbs10 A T 10: 111,135,118 (GRCm39) D77V probably damaging Het
Bltp2 A T 11: 78,165,438 (GRCm39) H1318L probably damaging Het
Bpifa1 T A 2: 153,986,256 (GRCm39) L127Q probably damaging Het
Brinp2 T C 1: 158,074,348 (GRCm39) N591S probably damaging Het
C2cd2 A C 16: 97,671,471 (GRCm39) V476G probably damaging Het
C7 T A 15: 5,041,494 (GRCm39) T471S possibly damaging Het
Cacna1b A T 2: 24,538,998 (GRCm39) Y1488N probably damaging Het
Cadps2 A G 6: 23,323,379 (GRCm39) F1001L probably damaging Het
Ccdc188 T C 16: 18,036,707 (GRCm39) S216P probably damaging Het
Ccdc24 A G 4: 117,729,213 (GRCm39) L88P probably damaging Het
Dab1 T C 4: 104,470,412 (GRCm39) I65T probably damaging Het
Dock4 A T 12: 40,780,062 (GRCm39) D621V probably damaging Het
Drd5 A T 5: 38,477,456 (GRCm39) M150L probably damaging Het
Eef2k T A 7: 120,472,569 (GRCm39) M94K possibly damaging Het
Epg5 A G 18: 78,025,521 (GRCm39) probably null Het
Epsti1 T C 14: 78,169,673 (GRCm39) probably null Het
Ern2 T A 7: 121,770,752 (GRCm39) D754V probably benign Het
Fbxo6 A G 4: 148,230,552 (GRCm39) Y237H probably damaging Het
Fbxw24 A G 9: 109,436,124 (GRCm39) S303P probably damaging Het
Fpr-rs3 A T 17: 20,844,103 (GRCm39) probably null Het
Gab1 G T 8: 81,493,010 (GRCm39) T679K probably damaging Het
Gbp9 C A 5: 105,253,590 (GRCm39) V42F probably damaging Het
Gbp9 A T 5: 105,253,652 (GRCm39) V21E probably damaging Het
Gm20821 A G Y: 9,783,927 (GRCm39) Q183R probably benign Het
Gpatch11 A T 17: 79,151,266 (GRCm39) I226F probably benign Het
Hephl1 T G 9: 14,965,848 (GRCm39) E1035A probably damaging Het
Hspa4l T C 3: 40,714,833 (GRCm39) V156A probably damaging Het
Ifna13 A G 4: 88,562,588 (GRCm39) V12A probably benign Het
Il24 G A 1: 130,810,268 (GRCm39) T196I probably benign Het
Irgm2 A G 11: 58,110,384 (GRCm39) D37G probably benign Het
Irs1 A G 1: 82,266,486 (GRCm39) S577P probably damaging Het
Kif21b G A 1: 136,075,284 (GRCm39) D166N probably damaging Het
Krtap4-16 T C 11: 99,742,322 (GRCm39) Q26R unknown Het
Lig1 T A 7: 13,043,067 (GRCm39) Y837* probably null Het
Lrrc69 T C 4: 14,708,669 (GRCm39) E225G possibly damaging Het
Map3k20 C T 2: 72,271,638 (GRCm39) Q589* probably null Het
Masp1 T G 16: 23,302,211 (GRCm39) M347L probably benign Het
Mgat3 A T 15: 80,096,390 (GRCm39) I406F probably benign Het
Mmp1b T G 9: 7,368,577 (GRCm39) D425A probably benign Het
Mss51 T C 14: 20,533,259 (GRCm39) H404R probably benign Het
Myo15b A T 11: 115,773,701 (GRCm39) H1911L probably benign Het
Nedd4l A G 18: 65,276,874 (GRCm39) D102G probably damaging Het
Niban3 T A 8: 72,056,404 (GRCm39) I368N possibly damaging Het
Npc2 T C 12: 84,807,523 (GRCm39) K112E probably benign Het
Nuggc T A 14: 65,879,370 (GRCm39) V694E probably damaging Het
Olfm1 T G 2: 28,104,718 (GRCm39) V157G probably benign Het
Or10h28 T C 17: 33,488,489 (GRCm39) S264P probably benign Het
Or5p55 T C 7: 107,566,877 (GRCm39) V91A probably benign Het
Otogl T A 10: 107,630,051 (GRCm39) probably null Het
Ovgp1 G A 3: 105,882,251 (GRCm39) C38Y probably damaging Het
Pisd A T 5: 32,894,672 (GRCm39) S344T probably damaging Het
Psme4 T C 11: 30,780,352 (GRCm39) V840A probably benign Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Rims2 T A 15: 39,208,710 (GRCm39) M171K probably damaging Het
Rin2 T A 2: 145,720,860 (GRCm39) M731K probably damaging Het
Scgb1b19 T C 7: 32,987,108 (GRCm39) probably null Het
Serpina10 A G 12: 103,594,514 (GRCm39) I235T possibly damaging Het
Setbp1 T A 18: 78,901,759 (GRCm39) E636V probably damaging Het
Sh3d21 C T 4: 126,056,290 (GRCm39) E101K probably damaging Het
Ski T G 4: 155,306,148 (GRCm39) D225A probably damaging Het
Slc28a2b A G 2: 122,357,910 (GRCm39) T655A probably benign Het
Slc29a3 T C 10: 60,559,593 (GRCm39) Y187C probably damaging Het
Sort1 T A 3: 108,253,043 (GRCm39) D494E possibly damaging Het
Sphkap A T 1: 83,255,643 (GRCm39) L702Q probably damaging Het
Srr A G 11: 74,799,545 (GRCm39) I285T probably damaging Het
Stam2 T C 2: 52,599,638 (GRCm39) T257A possibly damaging Het
Suds3 A T 5: 117,246,417 (GRCm39) N112K probably damaging Het
Tedc2 T A 17: 24,435,291 (GRCm39) E366V probably damaging Het
Tedc2 C A 17: 24,435,292 (GRCm39) E366* probably null Het
Tesk2 T C 4: 116,608,390 (GRCm39) L104P probably damaging Het
Tpo G T 12: 30,169,465 (GRCm39) A90E probably damaging Het
Trim30a T C 7: 104,060,672 (GRCm39) D368G probably damaging Het
Ugt2a2 A T 5: 87,608,438 (GRCm39) M633K possibly damaging Het
Vars2 A G 17: 35,970,953 (GRCm39) W626R probably damaging Het
Vmn2r10 A T 5: 109,154,120 (GRCm39) Y61* probably null Het
Vmn2r95 T C 17: 18,671,805 (GRCm39) V514A probably benign Het
Vwa5a T G 9: 38,649,110 (GRCm39) probably benign Het
Zfp365 A T 10: 67,745,686 (GRCm39) C31S probably damaging Het
Zfp397 A T 18: 24,093,108 (GRCm39) I198F possibly damaging Het
Zfp407 C T 18: 84,577,898 (GRCm39) A1072T probably benign Het
Zfp593 T C 4: 133,972,206 (GRCm39) E100G possibly damaging Het
Other mutations in Tie1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Tie1 APN 4 118,333,295 (GRCm39) missense probably damaging 1.00
IGL01679:Tie1 APN 4 118,339,936 (GRCm39) missense probably benign 0.00
IGL01821:Tie1 APN 4 118,341,835 (GRCm39) missense probably damaging 0.99
IGL01892:Tie1 APN 4 118,333,115 (GRCm39) missense probably benign
IGL02101:Tie1 APN 4 118,329,995 (GRCm39) missense probably benign 0.42
IGL02411:Tie1 APN 4 118,343,760 (GRCm39) nonsense probably null
IGL02421:Tie1 APN 4 118,343,591 (GRCm39) missense probably damaging 1.00
IGL02892:Tie1 APN 4 118,343,479 (GRCm39) missense probably damaging 1.00
IGL03294:Tie1 APN 4 118,337,420 (GRCm39) missense probably damaging 1.00
IGL03346:Tie1 APN 4 118,330,025 (GRCm39) missense probably damaging 1.00
R0064:Tie1 UTSW 4 118,346,898 (GRCm39) missense possibly damaging 0.94
R0067:Tie1 UTSW 4 118,333,477 (GRCm39) splice site probably benign
R0080:Tie1 UTSW 4 118,341,550 (GRCm39) missense probably damaging 1.00
R0082:Tie1 UTSW 4 118,341,550 (GRCm39) missense probably damaging 1.00
R0098:Tie1 UTSW 4 118,343,784 (GRCm39) missense probably benign
R0329:Tie1 UTSW 4 118,341,924 (GRCm39) missense probably benign 0.24
R0330:Tie1 UTSW 4 118,341,924 (GRCm39) missense probably benign 0.24
R0410:Tie1 UTSW 4 118,337,766 (GRCm39) missense probably damaging 1.00
R0472:Tie1 UTSW 4 118,333,344 (GRCm39) missense possibly damaging 0.61
R0498:Tie1 UTSW 4 118,336,358 (GRCm39) utr 3 prime probably benign
R0521:Tie1 UTSW 4 118,333,343 (GRCm39) missense probably damaging 1.00
R0609:Tie1 UTSW 4 118,333,344 (GRCm39) missense possibly damaging 0.61
R0675:Tie1 UTSW 4 118,336,966 (GRCm39) nonsense probably null
R0830:Tie1 UTSW 4 118,339,860 (GRCm39) missense probably damaging 1.00
R1541:Tie1 UTSW 4 118,341,070 (GRCm39) missense probably damaging 0.99
R1604:Tie1 UTSW 4 118,331,604 (GRCm39) missense probably damaging 1.00
R1731:Tie1 UTSW 4 118,333,460 (GRCm39) missense probably damaging 1.00
R1751:Tie1 UTSW 4 118,333,373 (GRCm39) missense possibly damaging 0.87
R1767:Tie1 UTSW 4 118,333,373 (GRCm39) missense possibly damaging 0.87
R1953:Tie1 UTSW 4 118,329,987 (GRCm39) critical splice donor site probably null
R2141:Tie1 UTSW 4 118,330,008 (GRCm39) nonsense probably null
R3150:Tie1 UTSW 4 118,333,022 (GRCm39) missense probably damaging 1.00
R4235:Tie1 UTSW 4 118,335,602 (GRCm39) nonsense probably null
R4599:Tie1 UTSW 4 118,329,831 (GRCm39) missense probably benign 0.00
R4614:Tie1 UTSW 4 118,336,248 (GRCm39) missense probably damaging 1.00
R4623:Tie1 UTSW 4 118,343,808 (GRCm39) missense possibly damaging 0.71
R4638:Tie1 UTSW 4 118,341,039 (GRCm39) missense probably benign 0.00
R4717:Tie1 UTSW 4 118,343,414 (GRCm39) missense probably damaging 1.00
R4936:Tie1 UTSW 4 118,341,968 (GRCm39) splice site silent
R4983:Tie1 UTSW 4 118,340,952 (GRCm39) missense probably damaging 1.00
R5202:Tie1 UTSW 4 118,337,707 (GRCm39) missense probably benign 0.01
R5234:Tie1 UTSW 4 118,339,959 (GRCm39) missense probably benign 0.22
R5243:Tie1 UTSW 4 118,339,548 (GRCm39) missense probably damaging 0.99
R5538:Tie1 UTSW 4 118,343,390 (GRCm39) missense probably benign 0.10
R5881:Tie1 UTSW 4 118,332,800 (GRCm39) missense possibly damaging 0.89
R6045:Tie1 UTSW 4 118,341,888 (GRCm39) missense probably benign 0.05
R6073:Tie1 UTSW 4 118,339,587 (GRCm39) missense probably benign
R6476:Tie1 UTSW 4 118,330,062 (GRCm39) missense possibly damaging 0.82
R6820:Tie1 UTSW 4 118,341,583 (GRCm39) missense probably damaging 1.00
R6961:Tie1 UTSW 4 118,343,402 (GRCm39) missense probably damaging 1.00
R7022:Tie1 UTSW 4 118,346,850 (GRCm39) missense probably benign 0.00
R7029:Tie1 UTSW 4 118,341,823 (GRCm39) missense possibly damaging 0.93
R7147:Tie1 UTSW 4 118,341,610 (GRCm39) missense probably damaging 1.00
R7249:Tie1 UTSW 4 118,343,425 (GRCm39) missense probably benign 0.29
R7410:Tie1 UTSW 4 118,337,074 (GRCm39) missense probably benign
R7486:Tie1 UTSW 4 118,337,101 (GRCm39) critical splice acceptor site probably null
R7637:Tie1 UTSW 4 118,330,175 (GRCm39) missense probably damaging 1.00
R7737:Tie1 UTSW 4 118,336,054 (GRCm39) splice site probably null
R7878:Tie1 UTSW 4 118,335,621 (GRCm39) missense probably damaging 1.00
R8012:Tie1 UTSW 4 118,343,678 (GRCm39) missense possibly damaging 0.77
R8478:Tie1 UTSW 4 118,341,979 (GRCm39) splice site probably null
R8716:Tie1 UTSW 4 118,339,935 (GRCm39) missense possibly damaging 0.76
R9075:Tie1 UTSW 4 118,341,356 (GRCm39) missense possibly damaging 0.93
R9347:Tie1 UTSW 4 118,341,867 (GRCm39) missense possibly damaging 0.68
R9361:Tie1 UTSW 4 118,336,829 (GRCm39) missense probably benign 0.00
R9409:Tie1 UTSW 4 118,339,945 (GRCm39) missense probably damaging 1.00
R9468:Tie1 UTSW 4 118,333,376 (GRCm39) missense probably damaging 1.00
R9530:Tie1 UTSW 4 118,343,817 (GRCm39) missense possibly damaging 0.64
R9545:Tie1 UTSW 4 118,336,112 (GRCm39) missense probably benign
R9615:Tie1 UTSW 4 118,347,032 (GRCm39) unclassified probably benign
R9733:Tie1 UTSW 4 118,330,183 (GRCm39) missense probably null 1.00
Z1088:Tie1 UTSW 4 118,341,626 (GRCm39) missense probably damaging 1.00
Z1176:Tie1 UTSW 4 118,331,374 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAAGAAGCTCCATGGTTGGG -3'
(R):5'- TAGAGTGACTGTGACTGACCCC -3'

Sequencing Primer
(F):5'- CTCCATGGTTGGGGGTAAG -3'
(R):5'- TGTGACTGACCCCACAGCTC -3'
Posted On 2014-08-25