Incidental Mutation 'R2026:Olfr616'
ID220619
Institutional Source Beutler Lab
Gene Symbol Olfr616
Ensembl Gene ENSMUSG00000047544
Gene Nameolfactory receptor 616
SynonymsMOR19-1, GA_x6K02T2PBJ9-6289676-6288723
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R2026 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location103563747-103569143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103564877 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 134 (Y134F)
Ref Sequence ENSEMBL: ENSMUSP00000150954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098198] [ENSMUST00000106886] [ENSMUST00000214345] [ENSMUST00000214806] [ENSMUST00000215673] [ENSMUST00000217293]
Predicted Effect probably benign
Transcript: ENSMUST00000098198
SMART Domains Protein: ENSMUSP00000095800
Gene: ENSMUSG00000073947

DomainStartEndE-ValueType
Pfam:7tm_4 32 311 2.5e-105 PFAM
Pfam:7TM_GPCR_Srsx 36 253 8.5e-9 PFAM
Pfam:7tm_1 42 293 8.2e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106886
AA Change: Y134F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102499
Gene: ENSMUSG00000047544
AA Change: Y134F

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:7tm_4 33 311 1.1e-116 PFAM
Pfam:7TM_GPCR_Srsx 37 309 1.2e-6 PFAM
Pfam:7tm_1 43 294 4.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214345
Predicted Effect probably damaging
Transcript: ENSMUST00000214806
AA Change: Y134F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215673
Predicted Effect probably damaging
Transcript: ENSMUST00000217293
AA Change: Y134F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik A G 8: 120,153,466 K269R probably benign Het
Abcc12 A G 8: 86,558,233 V251A probably benign Het
Avil G A 10: 127,011,873 G556S probably damaging Het
C3 T C 17: 57,218,562 Y898C probably damaging Het
Cacng2 A G 15: 77,995,520 F201L possibly damaging Het
Casp7 T A 19: 56,436,398 I183N probably damaging Het
Cntn3 A T 6: 102,420,427 W62R probably damaging Het
Ctrb1 T C 8: 111,688,685 N119S probably benign Het
Cyp3a59 G A 5: 146,096,288 V157M probably damaging Het
Dhfr G T 13: 92,365,771 G117* probably null Het
Dido1 A T 2: 180,689,181 L158* probably null Het
Dlg2 C A 7: 91,965,723 P290Q probably damaging Het
Dnah3 T A 7: 120,039,406 Q1240L probably damaging Het
Exd1 A T 2: 119,520,305 S492T probably benign Het
Fermt1 T C 2: 132,918,525 I415M probably benign Het
Fsip2 A G 2: 82,989,444 T5174A possibly damaging Het
Fuca2 T G 10: 13,512,647 V389G probably damaging Het
Gm14412 A T 2: 177,317,105 H50Q possibly damaging Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm5129 G A 5: 29,735,734 probably benign Het
Hif3a T C 7: 17,044,397 R437G possibly damaging Het
Hook3 T C 8: 26,038,098 E588G probably damaging Het
Hs1bp3 A G 12: 8,337,738 E301G probably benign Het
Icam2 A G 11: 106,382,442 F15L probably benign Het
Ice2 T C 9: 69,416,325 S701P probably benign Het
Igf2bp1 A G 11: 95,974,170 V151A possibly damaging Het
Lig4 A T 8: 9,972,436 L448Q probably damaging Het
Man2b1 G C 8: 85,095,335 W726C probably damaging Het
Mepe T C 5: 104,327,091 S13P possibly damaging Het
Msh6 C T 17: 87,990,343 H1264Y probably damaging Het
Ncoa1 A T 12: 4,267,647 S1228R probably benign Het
Ndufa10 A G 1: 92,439,892 Y339H probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Nutm2 A G 13: 50,474,820 H640R probably benign Het
Olfr1133 G T 2: 87,645,409 A238E probably damaging Het
Olfr1487 T A 19: 13,619,581 C140S probably damaging Het
Olfr266 T C 3: 106,821,711 I283V probably benign Het
Olfr31 T C 14: 14,328,891 V260A probably benign Het
Olfr801 T A 10: 129,670,465 D18V probably damaging Het
Pde1c C T 6: 56,180,190 V162I probably damaging Het
Pdss2 A T 10: 43,393,875 N238I possibly damaging Het
Pfas C T 11: 68,993,957 G473E probably damaging Het
Pkn1 A G 8: 83,671,378 V795A probably damaging Het
Polq A G 16: 37,062,745 D1757G possibly damaging Het
Popdc3 T C 10: 45,314,855 W21R probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rfc1 G T 5: 65,288,029 T412K probably damaging Het
Sap130 T C 18: 31,698,574 S706P possibly damaging Het
Scgn T C 13: 23,991,064 probably benign Het
Smad7 T C 18: 75,394,154 V357A probably damaging Het
Snrnp48 G T 13: 38,209,886 A56S possibly damaging Het
Sptbn1 G T 11: 30,104,559 A2178E probably benign Het
Syn2 C T 6: 115,278,251 T508I probably benign Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmtc4 T C 14: 122,921,265 N682S probably benign Het
Trpm7 T C 2: 126,812,738 K1427E probably benign Het
Trrap A G 5: 144,803,044 I1118V possibly damaging Het
Tslp A T 18: 32,815,672 I37L probably benign Het
Ttll3 G A 6: 113,398,770 V297M probably damaging Het
Ttn T C 2: 76,710,369 D34091G possibly damaging Het
Txndc11 CCCGCCGCCGCCGCCGC CCCGCCGCCGCCGC 16: 11,134,474 probably benign Het
Ube3a T C 7: 59,303,726 F803L probably damaging Het
Ubn1 A G 16: 5,064,650 E325G probably damaging Het
Wfikkn2 A G 11: 94,238,953 W121R possibly damaging Het
Zfp579 C A 7: 4,993,521 E464* probably null Het
Zfp616 A T 11: 74,083,587 L227F possibly damaging Het
Other mutations in Olfr616
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01640:Olfr616 APN 7 103565021 missense probably damaging 0.99
IGL02366:Olfr616 APN 7 103564415 missense probably damaging 1.00
IGL03028:Olfr616 APN 7 103564589 splice site probably null
R0087:Olfr616 UTSW 7 103564362 missense probably benign 0.00
R1450:Olfr616 UTSW 7 103564451 missense probably benign 0.12
R1900:Olfr616 UTSW 7 103564607 nonsense probably null
R2139:Olfr616 UTSW 7 103564754 missense possibly damaging 0.90
R2883:Olfr616 UTSW 7 103565264 missense probably benign 0.24
R4359:Olfr616 UTSW 7 103564535 missense probably benign 0.29
R4589:Olfr616 UTSW 7 103564432 missense probably damaging 0.98
R4827:Olfr616 UTSW 7 103564545 missense probably damaging 1.00
R5023:Olfr616 UTSW 7 103565171 missense possibly damaging 0.95
R5397:Olfr616 UTSW 7 103564506 missense probably damaging 0.99
R6109:Olfr616 UTSW 7 103565139 missense probably benign 0.12
R8090:Olfr616 UTSW 7 103564841 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCATAGATGATGTTGACCCTGAC -3'
(R):5'- TGGCAGCTACAGATGTTGGTC -3'

Sequencing Primer
(F):5'- ATGATGTTGACCCTGACAGGACC -3'
(R):5'- ACAGATGTTGGTCTCTCTGTATCAAC -3'
Posted On2014-08-25