Incidental Mutation 'R1986:Cadps2'
ID 220637
Institutional Source Beutler Lab
Gene Symbol Cadps2
Ensembl Gene ENSMUSG00000017978
Gene Name Ca2+-dependent activator protein for secretion 2
Synonyms Caps2, A230044C21Rik, cpd2
MMRRC Submission 039998-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1986 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 23262772-23839420 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 23323379 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 1001 (F1001L)
Ref Sequence ENSEMBL: ENSMUSP00000125972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018122] [ENSMUST00000069074] [ENSMUST00000115358] [ENSMUST00000115361] [ENSMUST00000125350] [ENSMUST00000142913] [ENSMUST00000163871] [ENSMUST00000166458]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000018122
AA Change: F1030L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978
AA Change: F1030L

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000069074
AA Change: F1023L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978
AA Change: F1023L

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 895 5.54e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115358
AA Change: F990L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978
AA Change: F990L

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115361
AA Change: F980L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111018
Gene: ENSMUSG00000017978
AA Change: F980L

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 892 1.9e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125350
AA Change: F625L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115866
Gene: ENSMUSG00000017978
AA Change: F625L

DomainStartEndE-ValueType
C2 14 112 1.51e-1 SMART
PH 137 241 2.94e-11 SMART
DUF1041 446 537 1.9e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000142913
AA Change: F1001L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978
AA Change: F1001L

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 22 39 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.14e-52 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163871
AA Change: F1030L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978
AA Change: F1030L

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 7.2e-50 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166458
AA Change: F1001L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978
AA Change: F1001L

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.05e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156986
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium-dependent activator of secretion (CAPS) protein family, which are calcium binding proteins that regulate the exocytosis of synaptic and dense-core vesicles in neurons and neuroendocrine cells. Mutations in this gene may contribute to autism susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in cerebellum, Purkinje cell and interneuron morphology, paired-pulse facilitation, and behaviors including emotional behavior, vestibuoocular reflex, circadium and sleep patterns, social investigation and nurturing behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,212,977 (GRCm39) S105P probably damaging Het
9930111J21Rik2 T A 11: 48,910,119 (GRCm39) K771N possibly damaging Het
Abcc2 A G 19: 43,818,318 (GRCm39) E1268G probably damaging Het
Adamts4 T C 1: 171,084,244 (GRCm39) F574L possibly damaging Het
Adamts9 A G 6: 92,773,375 (GRCm39) V1165A probably benign Het
Agap2 A T 10: 126,918,913 (GRCm39) K430* probably null Het
Amn G T 12: 111,241,431 (GRCm39) G232V probably damaging Het
Ank3 A G 10: 69,703,258 (GRCm39) E297G probably damaging Het
Arhgap45 T C 10: 79,856,530 (GRCm39) L26P probably damaging Het
Atp10b C A 11: 43,063,595 (GRCm39) Q177K probably benign Het
Bbs10 A T 10: 111,135,118 (GRCm39) D77V probably damaging Het
Bltp2 A T 11: 78,165,438 (GRCm39) H1318L probably damaging Het
Bpifa1 T A 2: 153,986,256 (GRCm39) L127Q probably damaging Het
Brinp2 T C 1: 158,074,348 (GRCm39) N591S probably damaging Het
C2cd2 A C 16: 97,671,471 (GRCm39) V476G probably damaging Het
C7 T A 15: 5,041,494 (GRCm39) T471S possibly damaging Het
Cacna1b A T 2: 24,538,998 (GRCm39) Y1488N probably damaging Het
Ccdc188 T C 16: 18,036,707 (GRCm39) S216P probably damaging Het
Ccdc24 A G 4: 117,729,213 (GRCm39) L88P probably damaging Het
Dab1 T C 4: 104,470,412 (GRCm39) I65T probably damaging Het
Dock4 A T 12: 40,780,062 (GRCm39) D621V probably damaging Het
Drd5 A T 5: 38,477,456 (GRCm39) M150L probably damaging Het
Eef2k T A 7: 120,472,569 (GRCm39) M94K possibly damaging Het
Epg5 A G 18: 78,025,521 (GRCm39) probably null Het
Epsti1 T C 14: 78,169,673 (GRCm39) probably null Het
Ern2 T A 7: 121,770,752 (GRCm39) D754V probably benign Het
Fbxo6 A G 4: 148,230,552 (GRCm39) Y237H probably damaging Het
Fbxw24 A G 9: 109,436,124 (GRCm39) S303P probably damaging Het
Fpr-rs3 A T 17: 20,844,103 (GRCm39) probably null Het
Gab1 G T 8: 81,493,010 (GRCm39) T679K probably damaging Het
Gbp9 C A 5: 105,253,590 (GRCm39) V42F probably damaging Het
Gbp9 A T 5: 105,253,652 (GRCm39) V21E probably damaging Het
Gm20821 A G Y: 9,783,927 (GRCm39) Q183R probably benign Het
Gpatch11 A T 17: 79,151,266 (GRCm39) I226F probably benign Het
Hephl1 T G 9: 14,965,848 (GRCm39) E1035A probably damaging Het
Hspa4l T C 3: 40,714,833 (GRCm39) V156A probably damaging Het
Ifna13 A G 4: 88,562,588 (GRCm39) V12A probably benign Het
Il24 G A 1: 130,810,268 (GRCm39) T196I probably benign Het
Irgm2 A G 11: 58,110,384 (GRCm39) D37G probably benign Het
Irs1 A G 1: 82,266,486 (GRCm39) S577P probably damaging Het
Kif21b G A 1: 136,075,284 (GRCm39) D166N probably damaging Het
Krtap4-16 T C 11: 99,742,322 (GRCm39) Q26R unknown Het
Lig1 T A 7: 13,043,067 (GRCm39) Y837* probably null Het
Lrrc69 T C 4: 14,708,669 (GRCm39) E225G possibly damaging Het
Map3k20 C T 2: 72,271,638 (GRCm39) Q589* probably null Het
Masp1 T G 16: 23,302,211 (GRCm39) M347L probably benign Het
Mgat3 A T 15: 80,096,390 (GRCm39) I406F probably benign Het
Mmp1b T G 9: 7,368,577 (GRCm39) D425A probably benign Het
Mss51 T C 14: 20,533,259 (GRCm39) H404R probably benign Het
Myo15b A T 11: 115,773,701 (GRCm39) H1911L probably benign Het
Nedd4l A G 18: 65,276,874 (GRCm39) D102G probably damaging Het
Niban3 T A 8: 72,056,404 (GRCm39) I368N possibly damaging Het
Npc2 T C 12: 84,807,523 (GRCm39) K112E probably benign Het
Nuggc T A 14: 65,879,370 (GRCm39) V694E probably damaging Het
Olfm1 T G 2: 28,104,718 (GRCm39) V157G probably benign Het
Or10h28 T C 17: 33,488,489 (GRCm39) S264P probably benign Het
Or5p55 T C 7: 107,566,877 (GRCm39) V91A probably benign Het
Otogl T A 10: 107,630,051 (GRCm39) probably null Het
Ovgp1 G A 3: 105,882,251 (GRCm39) C38Y probably damaging Het
Pisd A T 5: 32,894,672 (GRCm39) S344T probably damaging Het
Psme4 T C 11: 30,780,352 (GRCm39) V840A probably benign Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Rims2 T A 15: 39,208,710 (GRCm39) M171K probably damaging Het
Rin2 T A 2: 145,720,860 (GRCm39) M731K probably damaging Het
Scgb1b19 T C 7: 32,987,108 (GRCm39) probably null Het
Serpina10 A G 12: 103,594,514 (GRCm39) I235T possibly damaging Het
Setbp1 T A 18: 78,901,759 (GRCm39) E636V probably damaging Het
Sh3d21 C T 4: 126,056,290 (GRCm39) E101K probably damaging Het
Ski T G 4: 155,306,148 (GRCm39) D225A probably damaging Het
Slc28a2b A G 2: 122,357,910 (GRCm39) T655A probably benign Het
Slc29a3 T C 10: 60,559,593 (GRCm39) Y187C probably damaging Het
Sort1 T A 3: 108,253,043 (GRCm39) D494E possibly damaging Het
Sphkap A T 1: 83,255,643 (GRCm39) L702Q probably damaging Het
Srr A G 11: 74,799,545 (GRCm39) I285T probably damaging Het
Stam2 T C 2: 52,599,638 (GRCm39) T257A possibly damaging Het
Suds3 A T 5: 117,246,417 (GRCm39) N112K probably damaging Het
Tedc2 T A 17: 24,435,291 (GRCm39) E366V probably damaging Het
Tedc2 C A 17: 24,435,292 (GRCm39) E366* probably null Het
Tesk2 T C 4: 116,608,390 (GRCm39) L104P probably damaging Het
Tie1 C T 4: 118,336,160 (GRCm39) R702H probably benign Het
Tpo G T 12: 30,169,465 (GRCm39) A90E probably damaging Het
Trim30a T C 7: 104,060,672 (GRCm39) D368G probably damaging Het
Ugt2a2 A T 5: 87,608,438 (GRCm39) M633K possibly damaging Het
Vars2 A G 17: 35,970,953 (GRCm39) W626R probably damaging Het
Vmn2r10 A T 5: 109,154,120 (GRCm39) Y61* probably null Het
Vmn2r95 T C 17: 18,671,805 (GRCm39) V514A probably benign Het
Vwa5a T G 9: 38,649,110 (GRCm39) probably benign Het
Zfp365 A T 10: 67,745,686 (GRCm39) C31S probably damaging Het
Zfp397 A T 18: 24,093,108 (GRCm39) I198F possibly damaging Het
Zfp407 C T 18: 84,577,898 (GRCm39) A1072T probably benign Het
Zfp593 T C 4: 133,972,206 (GRCm39) E100G possibly damaging Het
Other mutations in Cadps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Cadps2 APN 6 23,496,873 (GRCm39) missense possibly damaging 0.84
IGL01105:Cadps2 APN 6 23,321,699 (GRCm39) splice site probably benign
IGL01317:Cadps2 APN 6 23,314,172 (GRCm39) missense possibly damaging 0.76
IGL01409:Cadps2 APN 6 23,587,440 (GRCm39) missense probably damaging 1.00
IGL01477:Cadps2 APN 6 23,263,672 (GRCm39) missense probably damaging 1.00
IGL01620:Cadps2 APN 6 23,587,461 (GRCm39) missense probably benign 0.19
IGL01674:Cadps2 APN 6 23,355,851 (GRCm39) missense probably damaging 1.00
IGL01675:Cadps2 APN 6 23,382,904 (GRCm39) missense probably damaging 1.00
IGL01895:Cadps2 APN 6 23,427,274 (GRCm39) missense probably damaging 0.98
IGL02095:Cadps2 APN 6 23,427,309 (GRCm39) missense probably benign 0.01
IGL02200:Cadps2 APN 6 23,385,527 (GRCm39) missense probably damaging 1.00
IGL02380:Cadps2 APN 6 23,287,731 (GRCm39) missense probably benign 0.11
IGL02680:Cadps2 APN 6 23,838,895 (GRCm39) missense probably damaging 0.99
IGL02814:Cadps2 APN 6 23,321,706 (GRCm39) missense probably damaging 1.00
IGL02940:Cadps2 APN 6 23,496,808 (GRCm39) missense probably benign 0.08
IGL03061:Cadps2 APN 6 23,287,659 (GRCm39) splice site probably null
IGL03233:Cadps2 APN 6 23,263,600 (GRCm39) missense probably benign 0.10
R0193:Cadps2 UTSW 6 23,599,439 (GRCm39) missense probably benign 0.00
R0389:Cadps2 UTSW 6 23,321,781 (GRCm39) missense possibly damaging 0.88
R0571:Cadps2 UTSW 6 23,583,411 (GRCm39) missense probably damaging 1.00
R0595:Cadps2 UTSW 6 23,321,703 (GRCm39) critical splice donor site probably null
R0620:Cadps2 UTSW 6 23,583,395 (GRCm39) missense probably damaging 1.00
R0723:Cadps2 UTSW 6 23,287,697 (GRCm39) missense probably damaging 0.99
R0831:Cadps2 UTSW 6 23,321,739 (GRCm39) missense possibly damaging 0.88
R0836:Cadps2 UTSW 6 23,328,775 (GRCm39) splice site probably benign
R0942:Cadps2 UTSW 6 23,263,561 (GRCm39) missense probably damaging 1.00
R1099:Cadps2 UTSW 6 23,599,478 (GRCm39) missense probably damaging 1.00
R1120:Cadps2 UTSW 6 23,838,793 (GRCm39) missense probably damaging 1.00
R1216:Cadps2 UTSW 6 23,583,472 (GRCm39) splice site probably benign
R1575:Cadps2 UTSW 6 23,429,217 (GRCm39) missense probably damaging 1.00
R1780:Cadps2 UTSW 6 23,320,931 (GRCm39) critical splice donor site probably null
R1924:Cadps2 UTSW 6 23,688,857 (GRCm39) missense probably damaging 0.99
R1944:Cadps2 UTSW 6 23,599,479 (GRCm39) missense probably damaging 0.99
R1956:Cadps2 UTSW 6 23,287,685 (GRCm39) missense probably damaging 1.00
R2045:Cadps2 UTSW 6 23,839,121 (GRCm39) missense possibly damaging 0.73
R2146:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2147:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2148:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2150:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2219:Cadps2 UTSW 6 23,410,831 (GRCm39) missense probably damaging 1.00
R2264:Cadps2 UTSW 6 23,323,339 (GRCm39) missense probably benign 0.15
R2338:Cadps2 UTSW 6 23,838,977 (GRCm39) splice site probably benign
R3861:Cadps2 UTSW 6 23,355,860 (GRCm39) missense probably damaging 1.00
R3898:Cadps2 UTSW 6 23,528,125 (GRCm39) missense probably damaging 1.00
R3982:Cadps2 UTSW 6 23,263,530 (GRCm39) utr 3 prime probably benign
R4213:Cadps2 UTSW 6 23,599,462 (GRCm39) missense probably damaging 1.00
R4384:Cadps2 UTSW 6 23,412,987 (GRCm39) missense probably benign 0.18
R4432:Cadps2 UTSW 6 23,626,737 (GRCm39) missense probably damaging 0.99
R4609:Cadps2 UTSW 6 23,587,578 (GRCm39) missense probably damaging 1.00
R4806:Cadps2 UTSW 6 23,688,859 (GRCm39) missense probably damaging 0.96
R4977:Cadps2 UTSW 6 23,599,478 (GRCm39) missense probably damaging 1.00
R5174:Cadps2 UTSW 6 23,287,742 (GRCm39) missense probably damaging 1.00
R5267:Cadps2 UTSW 6 23,626,667 (GRCm39) missense possibly damaging 0.79
R5389:Cadps2 UTSW 6 23,329,103 (GRCm39) missense probably damaging 1.00
R5737:Cadps2 UTSW 6 23,328,804 (GRCm39) missense probably benign 0.28
R6074:Cadps2 UTSW 6 23,626,670 (GRCm39) missense probably damaging 1.00
R6254:Cadps2 UTSW 6 23,329,162 (GRCm39) critical splice acceptor site probably null
R6323:Cadps2 UTSW 6 23,263,577 (GRCm39) missense probably benign 0.04
R6463:Cadps2 UTSW 6 23,323,333 (GRCm39) nonsense probably null
R6907:Cadps2 UTSW 6 23,599,505 (GRCm39) missense probably damaging 1.00
R6940:Cadps2 UTSW 6 23,302,491 (GRCm39) missense probably damaging 1.00
R6964:Cadps2 UTSW 6 23,583,458 (GRCm39) missense probably damaging 1.00
R7079:Cadps2 UTSW 6 23,323,408 (GRCm39) missense probably damaging 1.00
R7139:Cadps2 UTSW 6 23,410,888 (GRCm39) missense probably damaging 1.00
R7156:Cadps2 UTSW 6 23,688,955 (GRCm39) missense probably benign 0.02
R7184:Cadps2 UTSW 6 23,583,428 (GRCm39) missense probably benign 0.18
R7325:Cadps2 UTSW 6 23,409,934 (GRCm39) missense unknown
R7526:Cadps2 UTSW 6 23,496,850 (GRCm39) missense probably damaging 1.00
R7546:Cadps2 UTSW 6 23,626,607 (GRCm39) missense probably benign 0.15
R7772:Cadps2 UTSW 6 23,390,445 (GRCm39) missense probably benign 0.00
R7870:Cadps2 UTSW 6 23,263,641 (GRCm39) missense probably benign 0.14
R8040:Cadps2 UTSW 6 23,412,942 (GRCm39) splice site probably benign
R8048:Cadps2 UTSW 6 23,838,862 (GRCm39) missense probably benign 0.14
R8082:Cadps2 UTSW 6 23,323,313 (GRCm39) missense probably damaging 1.00
R8100:Cadps2 UTSW 6 23,838,808 (GRCm39) missense probably damaging 1.00
R8115:Cadps2 UTSW 6 23,328,897 (GRCm39) missense probably benign 0.00
R8497:Cadps2 UTSW 6 23,355,918 (GRCm39) missense probably benign 0.27
R8768:Cadps2 UTSW 6 23,382,938 (GRCm39) missense probably damaging 1.00
R8783:Cadps2 UTSW 6 23,302,303 (GRCm39) missense possibly damaging 0.57
R8804:Cadps2 UTSW 6 23,496,805 (GRCm39) missense probably damaging 1.00
R8832:Cadps2 UTSW 6 23,587,536 (GRCm39) missense possibly damaging 0.52
R8848:Cadps2 UTSW 6 23,344,256 (GRCm39) missense probably damaging 1.00
R8854:Cadps2 UTSW 6 23,385,507 (GRCm39) missense probably damaging 1.00
R8896:Cadps2 UTSW 6 23,410,876 (GRCm39) missense probably damaging 1.00
R8910:Cadps2 UTSW 6 23,344,223 (GRCm39) missense probably benign 0.11
R8921:Cadps2 UTSW 6 23,302,300 (GRCm39) missense probably benign 0.00
R9228:Cadps2 UTSW 6 23,688,927 (GRCm39) missense probably benign 0.00
R9297:Cadps2 UTSW 6 23,496,887 (GRCm39) missense probably benign
R9318:Cadps2 UTSW 6 23,496,887 (GRCm39) missense probably benign
R9348:Cadps2 UTSW 6 23,344,262 (GRCm39) missense probably benign 0.20
R9447:Cadps2 UTSW 6 23,323,297 (GRCm39) missense probably damaging 0.96
R9484:Cadps2 UTSW 6 23,626,646 (GRCm39) missense probably benign 0.02
R9492:Cadps2 UTSW 6 23,427,238 (GRCm39) missense probably benign
R9630:Cadps2 UTSW 6 23,587,571 (GRCm39) missense probably benign 0.08
R9729:Cadps2 UTSW 6 23,382,982 (GRCm39) missense probably benign 0.28
Z1176:Cadps2 UTSW 6 23,321,800 (GRCm39) missense probably benign 0.24
Z1177:Cadps2 UTSW 6 23,838,817 (GRCm39) missense probably damaging 1.00
Z1177:Cadps2 UTSW 6 23,626,694 (GRCm39) missense probably damaging 1.00
Z1177:Cadps2 UTSW 6 23,385,477 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CCCCAGGATTAAGGTCAGAGAAC -3'
(R):5'- CTGAAGAGAGCACTGGATCATG -3'

Sequencing Primer
(F):5'- CAGTTCTTCCCTGTGACAATTAAG -3'
(R):5'- GCACTGGATCATGAAAGATTGTATG -3'
Posted On 2014-08-25