Mutagenetix > Incidental Mutation

Incidental Mutation 'R1986:Cadps2'

220637

Institutional Source

Beutler Lab

Gene Symbol

Cadps2

Ensembl Gene

ENSMUSG00000017978

Gene Name

Ca2+-dependent activator protein for secretion 2

Synonyms

Caps2, cpd2, A230044C21Rik

MMRRC Submission

039998-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1986 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

23262773-23839421 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 23323380 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 1001 (F1001L)

Ref Sequence

ENSEMBL: ENSMUSP00000125972 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018122] [ENSMUST00000069074] [ENSMUST00000115358] [ENSMUST00000115361] [ENSMUST00000125350] [ENSMUST00000142913] [ENSMUST00000163871] [ENSMUST00000166458]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000018122
AA Change: F1030L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978
AA Change: F1030L

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	1.14e-52	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000069074
AA Change: F1023L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978
AA Change: F1023L

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	895	5.54e-51	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000115358
AA Change: F990L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978
AA Change: F990L

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	1.14e-52	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000115361
AA Change: F980L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000111018
Gene: ENSMUSG00000017978
AA Change: F980L

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	892	1.9e-49	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000125350
AA Change: F625L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000115866
Gene: ENSMUSG00000017978
AA Change: F625L

Domain	Start	End	E-Value	Type
C2	14	112	1.51e-1	SMART
PH	137	241	2.94e-11	SMART
DUF1041	446	537	1.9e-49	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000142913
AA Change: F1001L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978
AA Change: F1001L

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	22	39	N/A	INTRINSIC
low complexity region	85	97	N/A	INTRINSIC
coiled coil region	236	256	N/A	INTRINSIC
C2	340	438	1.51e-1	SMART
PH	463	567	2.94e-11	SMART
DUF1041	772	873	1.14e-52	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156986

Predicted Effect

probably damaging
Transcript: ENSMUST00000163871
AA Change: F1030L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978
AA Change: F1030L

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	7.2e-50	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000166458
AA Change: F1001L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978
AA Change: F1001L

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	85	97	N/A	INTRINSIC
coiled coil region	236	256	N/A	INTRINSIC
C2	340	438	1.51e-1	SMART
PH	463	567	2.94e-11	SMART
DUF1041	772	873	1.05e-51	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium-dependent activator of secretion (CAPS) protein family, which are calcium binding proteins that regulate the exocytosis of synaptic and dense-core vesicles in neurons and neuroendocrine cells. Mutations in this gene may contribute to autism susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in cerebellum, Purkinje cell and interneuron morphology, paired-pulse facilitation, and behaviors including emotional behavior, vestibuoocular reflex, circadium and sleep patterns, social investigation and nurturing behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	G	3: 124,419,328	S105P	probably damaging	Het
2610507B11Rik	A	T	11: 78,274,612	H1318L	probably damaging	Het
9930111J21Rik2	T	A	11: 49,019,292	K771N	possibly damaging	Het
Abcc2	A	G	19: 43,829,879	E1268G	probably damaging	Het
Adamts4	T	C	1: 171,256,675	F574L	possibly damaging	Het
Adamts9	A	G	6: 92,796,394	V1165A	probably benign	Het
Agap2	A	T	10: 127,083,044	K430*	probably null	Het
Amn	G	T	12: 111,274,997	G232V	probably damaging	Het
Ank3	A	G	10: 69,867,428	E297G	probably damaging	Het
Arhgap45	T	C	10: 80,020,696	L26P	probably damaging	Het
Atp10b	C	A	11: 43,172,768	Q177K	probably benign	Het
Bbs10	A	T	10: 111,299,257	D77V	probably damaging	Het
Bpifa1	T	A	2: 154,144,336	L127Q	probably damaging	Het
Brinp2	T	C	1: 158,246,778	N591S	probably damaging	Het
C2cd2	A	C	16: 97,870,271	V476G	probably damaging	Het
C7	T	A	15: 5,012,012	T471S	possibly damaging	Het
Cacna1b	A	T	2: 24,648,986	Y1488N	probably damaging	Het
Ccdc188	T	C	16: 18,218,843	S216P	probably damaging	Het
Ccdc24	A	G	4: 117,872,016	L88P	probably damaging	Het
Dab1	T	C	4: 104,613,215	I65T	probably damaging	Het
Dock4	A	T	12: 40,730,063	D621V	probably damaging	Het
Drd5	A	T	5: 38,320,113	M150L	probably damaging	Het
Eef2k	T	A	7: 120,873,346	M94K	possibly damaging	Het
Epg5	A	G	18: 77,982,306		probably null	Het
Epsti1	T	C	14: 77,932,233		probably null	Het
Ern2	T	A	7: 122,171,529	D754V	probably benign	Het
Fam129c	T	A	8: 71,603,760	I368N	possibly damaging	Het
Fbxo6	A	G	4: 148,146,095	Y237H	probably damaging	Het
Fbxw24	A	G	9: 109,607,056	S303P	probably damaging	Het
Fpr-rs3	A	T	17: 20,623,841		probably null	Het
Gab1	G	T	8: 80,766,381	T679K	probably damaging	Het
Gbp9	C	A	5: 105,105,724	V42F	probably damaging	Het
Gbp9	A	T	5: 105,105,786	V21E	probably damaging	Het
Gm14085	A	G	2: 122,527,429	T655A	probably benign	Het
Gm20821	A	G	Y: 9,783,927	Q183R	probably benign	Het
Gpatch11	A	T	17: 78,843,837	I226F	probably benign	Het
Hephl1	T	G	9: 15,054,552	E1035A	probably damaging	Het
Hspa4l	T	C	3: 40,760,401	V156A	probably damaging	Het
Ifna13	A	G	4: 88,644,351	V12A	probably benign	Het
Il24	G	A	1: 130,882,531	T196I	probably benign	Het
Irgm2	A	G	11: 58,219,558	D37G	probably benign	Het
Irs1	A	G	1: 82,288,765	S577P	probably damaging	Het
Kif21b	G	A	1: 136,147,546	D166N	probably damaging	Het
Krtap4-16	T	C	11: 99,851,496	Q26R	unknown	Het
Lig1	T	A	7: 13,309,142	Y837*	probably null	Het
Lrrc69	T	C	4: 14,708,669	E225G	possibly damaging	Het
Map3k20	C	T	2: 72,441,294	Q589*	probably null	Het
Masp1	T	G	16: 23,483,461	M347L	probably benign	Het
Mgat3	A	T	15: 80,212,189	I406F	probably benign	Het
Mmp1b	T	G	9: 7,368,577	D425A	probably benign	Het
Mss51	T	C	14: 20,483,191	H404R	probably benign	Het
Myo15b	A	T	11: 115,882,875	H1911L	probably benign	Het
Nedd4l	A	G	18: 65,143,803	D102G	probably damaging	Het
Npc2	T	C	12: 84,760,749	K112E	probably benign	Het
Nuggc	T	A	14: 65,641,921	V694E	probably damaging	Het
Olfm1	T	G	2: 28,214,706	V157G	probably benign	Het
Olfr476	T	C	7: 107,967,670	V91A	probably benign	Het
Olfr63	T	C	17: 33,269,515	S264P	probably benign	Het
Otogl	T	A	10: 107,794,190		probably null	Het
Ovgp1	G	A	3: 105,974,935	C38Y	probably damaging	Het
Pisd	A	T	5: 32,737,328	S344T	probably damaging	Het
Psme4	T	C	11: 30,830,352	V840A	probably benign	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Rims2	T	A	15: 39,345,314	M171K	probably damaging	Het
Rin2	T	A	2: 145,878,940	M731K	probably damaging	Het
Scgb1b19	T	C	7: 33,287,683		probably null	Het
Serpina10	A	G	12: 103,628,255	I235T	possibly damaging	Het
Setbp1	T	A	18: 78,858,544	E636V	probably damaging	Het
Sh3d21	C	T	4: 126,162,497	E101K	probably damaging	Het
Ski	T	G	4: 155,221,691	D225A	probably damaging	Het
Slc29a3	T	C	10: 60,723,814	Y187C	probably damaging	Het
Sort1	T	A	3: 108,345,727	D494E	possibly damaging	Het
Sphkap	A	T	1: 83,277,922	L702Q	probably damaging	Het
Srr	A	G	11: 74,908,719	I285T	probably damaging	Het
Stam2	T	C	2: 52,709,626	T257A	possibly damaging	Het
Suds3	A	T	5: 117,108,352	N112K	probably damaging	Het
Tedc2	T	A	17: 24,216,317	E366V	probably damaging	Het
Tedc2	C	A	17: 24,216,318	E366*	probably null	Het
Tesk2	T	C	4: 116,751,193	L104P	probably damaging	Het
Tie1	C	T	4: 118,478,963	R702H	probably benign	Het
Tpo	G	T	12: 30,119,466	A90E	probably damaging	Het
Trim30a	T	C	7: 104,411,465	D368G	probably damaging	Het
Ugt2a2	A	T	5: 87,460,579	M633K	possibly damaging	Het
Vars2	A	G	17: 35,660,061	W626R	probably damaging	Het
Vmn2r10	A	T	5: 109,006,254	Y61*	probably null	Het
Vmn2r95	T	C	17: 18,451,543	V514A	probably benign	Het
Vwa5a	T	G	9: 38,737,814		probably benign	Het
Zfp365	A	T	10: 67,909,856	C31S	probably damaging	Het
Zfp397	A	T	18: 23,960,051	I198F	possibly damaging	Het
Zfp407	C	T	18: 84,559,773	A1072T	probably benign	Het
Zfp593	T	C	4: 134,244,895	E100G	possibly damaging	Het

Other mutations in Cadps2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Cadps2	APN	6	23496874	missense	possibly damaging	0.84
IGL01105:Cadps2	APN	6	23321700	splice site	probably benign
IGL01317:Cadps2	APN	6	23314173	missense	possibly damaging	0.76
IGL01409:Cadps2	APN	6	23587441	missense	probably damaging	1.00
IGL01477:Cadps2	APN	6	23263673	missense	probably damaging	1.00
IGL01620:Cadps2	APN	6	23587462	missense	probably benign	0.19
IGL01674:Cadps2	APN	6	23355852	missense	probably damaging	1.00
IGL01675:Cadps2	APN	6	23382905	missense	probably damaging	1.00
IGL01895:Cadps2	APN	6	23427275	missense	probably damaging	0.98
IGL02095:Cadps2	APN	6	23427310	missense	probably benign	0.01
IGL02200:Cadps2	APN	6	23385528	missense	probably damaging	1.00
IGL02380:Cadps2	APN	6	23287732	missense	probably benign	0.11
IGL02680:Cadps2	APN	6	23838896	missense	probably damaging	0.99
IGL02814:Cadps2	APN	6	23321707	missense	probably damaging	1.00
IGL02940:Cadps2	APN	6	23496809	missense	probably benign	0.08
IGL03061:Cadps2	APN	6	23287660	splice site	probably null
IGL03233:Cadps2	APN	6	23263601	missense	probably benign	0.10
R0193:Cadps2	UTSW	6	23599440	missense	probably benign	0.00
R0389:Cadps2	UTSW	6	23321782	missense	possibly damaging	0.88
R0571:Cadps2	UTSW	6	23583412	missense	probably damaging	1.00
R0595:Cadps2	UTSW	6	23321704	critical splice donor site	probably null
R0620:Cadps2	UTSW	6	23583396	missense	probably damaging	1.00
R0723:Cadps2	UTSW	6	23287698	missense	probably damaging	0.99
R0831:Cadps2	UTSW	6	23321740	missense	possibly damaging	0.88
R0836:Cadps2	UTSW	6	23328776	splice site	probably benign
R0942:Cadps2	UTSW	6	23263562	missense	probably damaging	1.00
R1099:Cadps2	UTSW	6	23599479	missense	probably damaging	1.00
R1120:Cadps2	UTSW	6	23838794	missense	probably damaging	1.00
R1216:Cadps2	UTSW	6	23583473	splice site	probably benign
R1575:Cadps2	UTSW	6	23429218	missense	probably damaging	1.00
R1780:Cadps2	UTSW	6	23320932	critical splice donor site	probably null
R1924:Cadps2	UTSW	6	23688858	missense	probably damaging	0.99
R1944:Cadps2	UTSW	6	23599480	missense	probably damaging	0.99
R1956:Cadps2	UTSW	6	23287686	missense	probably damaging	1.00
R2045:Cadps2	UTSW	6	23839122	missense	possibly damaging	0.73
R2146:Cadps2	UTSW	6	23838999	intron	probably benign
R2147:Cadps2	UTSW	6	23838999	intron	probably benign
R2148:Cadps2	UTSW	6	23838999	intron	probably benign
R2150:Cadps2	UTSW	6	23838999	intron	probably benign
R2219:Cadps2	UTSW	6	23410832	missense	probably damaging	1.00
R2264:Cadps2	UTSW	6	23323340	missense	probably benign	0.15
R2338:Cadps2	UTSW	6	23838978	splice site	probably benign
R3861:Cadps2	UTSW	6	23355861	missense	probably damaging	1.00
R3898:Cadps2	UTSW	6	23528126	missense	probably damaging	1.00
R3982:Cadps2	UTSW	6	23263531	utr 3 prime	probably benign
R4213:Cadps2	UTSW	6	23599463	missense	probably damaging	1.00
R4384:Cadps2	UTSW	6	23412988	missense	probably benign	0.18
R4432:Cadps2	UTSW	6	23626738	missense	probably damaging	0.99
R4609:Cadps2	UTSW	6	23587579	missense	probably damaging	1.00
R4806:Cadps2	UTSW	6	23688860	missense	probably damaging	0.96
R4977:Cadps2	UTSW	6	23599479	missense	probably damaging	1.00
R5174:Cadps2	UTSW	6	23287743	missense	probably damaging	1.00
R5267:Cadps2	UTSW	6	23626668	missense	possibly damaging	0.79
R5389:Cadps2	UTSW	6	23329104	missense	probably damaging	1.00
R5737:Cadps2	UTSW	6	23328805	missense	probably benign	0.28
R6074:Cadps2	UTSW	6	23626671	missense	probably damaging	1.00
R6254:Cadps2	UTSW	6	23329163	critical splice acceptor site	probably null
R6323:Cadps2	UTSW	6	23263578	missense	probably benign	0.04
R6463:Cadps2	UTSW	6	23323334	nonsense	probably null
R6907:Cadps2	UTSW	6	23599506	missense	probably damaging	1.00
R6940:Cadps2	UTSW	6	23302492	missense	probably damaging	1.00
R6964:Cadps2	UTSW	6	23583459	missense	probably damaging	1.00
R7079:Cadps2	UTSW	6	23323409	missense	probably damaging	1.00
R7139:Cadps2	UTSW	6	23410889	missense	probably damaging	1.00
R7156:Cadps2	UTSW	6	23688956	missense	probably benign	0.02
R7184:Cadps2	UTSW	6	23583429	missense	probably benign	0.18
R7325:Cadps2	UTSW	6	23409935	missense	unknown
R7526:Cadps2	UTSW	6	23496851	missense	probably damaging	1.00
R7546:Cadps2	UTSW	6	23626608	missense	probably benign	0.15
R7772:Cadps2	UTSW	6	23390446	missense	probably benign	0.00
R7870:Cadps2	UTSW	6	23263642	missense	probably benign	0.14
R8040:Cadps2	UTSW	6	23412943	splice site	probably benign
R8048:Cadps2	UTSW	6	23838863	missense	probably benign	0.14
R8082:Cadps2	UTSW	6	23323314	missense	probably damaging	1.00
R8100:Cadps2	UTSW	6	23838809	missense	probably damaging	1.00
R8115:Cadps2	UTSW	6	23328898	missense	probably benign	0.00
R8497:Cadps2	UTSW	6	23355919	missense	probably benign	0.27
R8768:Cadps2	UTSW	6	23382939	missense	probably damaging	1.00
R8783:Cadps2	UTSW	6	23302304	missense	possibly damaging	0.57
R8804:Cadps2	UTSW	6	23496806	missense	probably damaging	1.00
R8832:Cadps2	UTSW	6	23587537	missense	possibly damaging	0.52
R8848:Cadps2	UTSW	6	23344257	missense	probably damaging	1.00
R8854:Cadps2	UTSW	6	23385508	missense	probably damaging	1.00
R8896:Cadps2	UTSW	6	23410877	missense	probably damaging	1.00
R8910:Cadps2	UTSW	6	23344224	missense	probably benign	0.11
R8921:Cadps2	UTSW	6	23302301	missense	probably benign	0.00
R9228:Cadps2	UTSW	6	23688928	missense	probably benign	0.00
R9297:Cadps2	UTSW	6	23496888	missense	probably benign
R9318:Cadps2	UTSW	6	23496888	missense	probably benign
R9348:Cadps2	UTSW	6	23344263	missense	probably benign	0.20
R9447:Cadps2	UTSW	6	23323298	missense	probably damaging	0.96
R9484:Cadps2	UTSW	6	23626647	missense	probably benign	0.02
R9492:Cadps2	UTSW	6	23427239	missense	probably benign
R9630:Cadps2	UTSW	6	23587572	missense	probably benign	0.08
R9729:Cadps2	UTSW	6	23382983	missense	probably benign	0.28
Z1176:Cadps2	UTSW	6	23321801	missense	probably benign	0.24
Z1177:Cadps2	UTSW	6	23385478	missense	possibly damaging	0.88
Z1177:Cadps2	UTSW	6	23626695	missense	probably damaging	1.00
Z1177:Cadps2	UTSW	6	23838818	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCCAGGATTAAGGTCAGAGAAC -3'
(R):5'- CTGAAGAGAGCACTGGATCATG -3'

Sequencing Primer
(F):5'- CAGTTCTTCCCTGTGACAATTAAG -3'
(R):5'- GCACTGGATCATGAAAGATTGTATG -3'

Posted On

2014-08-25