Mutagenetix > Incidental Mutation

Incidental Mutation 'R1986:Adamts9'

220639

Institutional Source

Beutler Lab

Gene Symbol

Adamts9

Ensembl Gene

ENSMUSG00000030022

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 9

Synonyms

8430403M15Rik, E030027K14Rik, 1810011L16Rik

MMRRC Submission

039998-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1986 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

92772699-92943492 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 92796394 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1165 (V1165A)

Ref Sequence

ENSEMBL: ENSMUSP00000126498 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113438] [ENSMUST00000167391]

AlphaFold

E9PUN6

Predicted Effect

probably benign
Transcript: ENSMUST00000113438
AA Change: V1746A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000109065
Gene: ENSMUSG00000030022
AA Change: V1746A

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:Pep_M12B_propep	49	207	1.8e-37	PFAM
low complexity region	234	247	N/A	INTRINSIC
Pfam:Reprolysin_5	291	476	7.6e-17	PFAM
Pfam:Reprolysin_4	291	495	2e-11	PFAM
Pfam:Reprolysin	293	499	7.4e-29	PFAM
Pfam:Reprolysin_2	310	489	1e-13	PFAM
Pfam:Reprolysin_3	314	445	1.7e-14	PFAM
TSP1	591	643	2.15e-9	SMART
Pfam:ADAM_spacer1	753	871	7.3e-35	PFAM
TSP1	881	936	1.14e0	SMART
Blast:TSP1	938	993	2e-28	BLAST
TSP1	1000	1054	3.78e-5	SMART
TSP1	1055	1109	5.64e-4	SMART
TSP1	1110	1166	1.25e-5	SMART
TSP1	1186	1240	1.45e-6	SMART
TSP1	1242	1296	4.41e-6	SMART
TSP1	1328	1380	7.06e-5	SMART
TSP1	1381	1436	4.24e-8	SMART
TSP1	1440	1495	8.23e-6	SMART
TSP1	1496	1551	1.23e-4	SMART
TSP1	1552	1609	2e-4	SMART
TSP1	1611	1672	1.25e-5	SMART
TSP1	1676	1730	3.47e-4	SMART
Pfam:GON	1732	1930	1.6e-85	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125490

Predicted Effect

probably benign
Transcript: ENSMUST00000167391
AA Change: V1165A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000126498
Gene: ENSMUSG00000030022
AA Change: V1165A

Domain	Start	End	E-Value	Type
TSP1	10	62	2.15e-9	SMART
Pfam:ADAM_spacer1	172	290	6.1e-35	PFAM
TSP1	300	355	1.14e0	SMART
Blast:TSP1	357	412	3e-28	BLAST
TSP1	419	473	3.78e-5	SMART
TSP1	474	528	5.64e-4	SMART
TSP1	529	585	1.25e-5	SMART
TSP1	605	659	1.45e-6	SMART
TSP1	661	715	4.41e-6	SMART
TSP1	747	799	7.06e-5	SMART
TSP1	800	855	4.24e-8	SMART
TSP1	859	914	8.23e-6	SMART
TSP1	915	970	1.23e-4	SMART
TSP1	971	1028	2e-4	SMART
TSP1	1030	1091	1.25e-5	SMART
TSP1	1095	1149	3.47e-4	SMART
Pfam:GON	1150	1350	2.1e-86	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. Members of the ADAMTS family have been implicated in the cleavage of proteoglycans, the control of organ shape during development, and the inhibition of angiogenesis. This gene is localized to chromosome 3p14.3-p14.2, an area known to be lost in hereditary renal tumors. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	G	3: 124,419,328	S105P	probably damaging	Het
2610507B11Rik	A	T	11: 78,274,612	H1318L	probably damaging	Het
9930111J21Rik2	T	A	11: 49,019,292	K771N	possibly damaging	Het
Abcc2	A	G	19: 43,829,879	E1268G	probably damaging	Het
Adamts4	T	C	1: 171,256,675	F574L	possibly damaging	Het
Agap2	A	T	10: 127,083,044	K430*	probably null	Het
Amn	G	T	12: 111,274,997	G232V	probably damaging	Het
Ank3	A	G	10: 69,867,428	E297G	probably damaging	Het
Arhgap45	T	C	10: 80,020,696	L26P	probably damaging	Het
Atp10b	C	A	11: 43,172,768	Q177K	probably benign	Het
Bbs10	A	T	10: 111,299,257	D77V	probably damaging	Het
Bpifa1	T	A	2: 154,144,336	L127Q	probably damaging	Het
Brinp2	T	C	1: 158,246,778	N591S	probably damaging	Het
C2cd2	A	C	16: 97,870,271	V476G	probably damaging	Het
C7	T	A	15: 5,012,012	T471S	possibly damaging	Het
Cacna1b	A	T	2: 24,648,986	Y1488N	probably damaging	Het
Cadps2	A	G	6: 23,323,380	F1001L	probably damaging	Het
Ccdc188	T	C	16: 18,218,843	S216P	probably damaging	Het
Ccdc24	A	G	4: 117,872,016	L88P	probably damaging	Het
Dab1	T	C	4: 104,613,215	I65T	probably damaging	Het
Dock4	A	T	12: 40,730,063	D621V	probably damaging	Het
Drd5	A	T	5: 38,320,113	M150L	probably damaging	Het
Eef2k	T	A	7: 120,873,346	M94K	possibly damaging	Het
Epg5	A	G	18: 77,982,306		probably null	Het
Epsti1	T	C	14: 77,932,233		probably null	Het
Ern2	T	A	7: 122,171,529	D754V	probably benign	Het
Fam129c	T	A	8: 71,603,760	I368N	possibly damaging	Het
Fbxo6	A	G	4: 148,146,095	Y237H	probably damaging	Het
Fbxw24	A	G	9: 109,607,056	S303P	probably damaging	Het
Fpr-rs3	A	T	17: 20,623,841		probably null	Het
Gab1	G	T	8: 80,766,381	T679K	probably damaging	Het
Gbp9	C	A	5: 105,105,724	V42F	probably damaging	Het
Gbp9	A	T	5: 105,105,786	V21E	probably damaging	Het
Gm14085	A	G	2: 122,527,429	T655A	probably benign	Het
Gm20821	A	G	Y: 9,783,927	Q183R	probably benign	Het
Gpatch11	A	T	17: 78,843,837	I226F	probably benign	Het
Hephl1	T	G	9: 15,054,552	E1035A	probably damaging	Het
Hspa4l	T	C	3: 40,760,401	V156A	probably damaging	Het
Ifna13	A	G	4: 88,644,351	V12A	probably benign	Het
Il24	G	A	1: 130,882,531	T196I	probably benign	Het
Irgm2	A	G	11: 58,219,558	D37G	probably benign	Het
Irs1	A	G	1: 82,288,765	S577P	probably damaging	Het
Kif21b	G	A	1: 136,147,546	D166N	probably damaging	Het
Krtap4-16	T	C	11: 99,851,496	Q26R	unknown	Het
Lig1	T	A	7: 13,309,142	Y837*	probably null	Het
Lrrc69	T	C	4: 14,708,669	E225G	possibly damaging	Het
Map3k20	C	T	2: 72,441,294	Q589*	probably null	Het
Masp1	T	G	16: 23,483,461	M347L	probably benign	Het
Mgat3	A	T	15: 80,212,189	I406F	probably benign	Het
Mmp1b	T	G	9: 7,368,577	D425A	probably benign	Het
Mss51	T	C	14: 20,483,191	H404R	probably benign	Het
Myo15b	A	T	11: 115,882,875	H1911L	probably benign	Het
Nedd4l	A	G	18: 65,143,803	D102G	probably damaging	Het
Npc2	T	C	12: 84,760,749	K112E	probably benign	Het
Nuggc	T	A	14: 65,641,921	V694E	probably damaging	Het
Olfm1	T	G	2: 28,214,706	V157G	probably benign	Het
Olfr476	T	C	7: 107,967,670	V91A	probably benign	Het
Olfr63	T	C	17: 33,269,515	S264P	probably benign	Het
Otogl	T	A	10: 107,794,190		probably null	Het
Ovgp1	G	A	3: 105,974,935	C38Y	probably damaging	Het
Pisd	A	T	5: 32,737,328	S344T	probably damaging	Het
Psme4	T	C	11: 30,830,352	V840A	probably benign	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Rims2	T	A	15: 39,345,314	M171K	probably damaging	Het
Rin2	T	A	2: 145,878,940	M731K	probably damaging	Het
Scgb1b19	T	C	7: 33,287,683		probably null	Het
Serpina10	A	G	12: 103,628,255	I235T	possibly damaging	Het
Setbp1	T	A	18: 78,858,544	E636V	probably damaging	Het
Sh3d21	C	T	4: 126,162,497	E101K	probably damaging	Het
Ski	T	G	4: 155,221,691	D225A	probably damaging	Het
Slc29a3	T	C	10: 60,723,814	Y187C	probably damaging	Het
Sort1	T	A	3: 108,345,727	D494E	possibly damaging	Het
Sphkap	A	T	1: 83,277,922	L702Q	probably damaging	Het
Srr	A	G	11: 74,908,719	I285T	probably damaging	Het
Stam2	T	C	2: 52,709,626	T257A	possibly damaging	Het
Suds3	A	T	5: 117,108,352	N112K	probably damaging	Het
Tedc2	T	A	17: 24,216,317	E366V	probably damaging	Het
Tedc2	C	A	17: 24,216,318	E366*	probably null	Het
Tesk2	T	C	4: 116,751,193	L104P	probably damaging	Het
Tie1	C	T	4: 118,478,963	R702H	probably benign	Het
Tpo	G	T	12: 30,119,466	A90E	probably damaging	Het
Trim30a	T	C	7: 104,411,465	D368G	probably damaging	Het
Ugt2a2	A	T	5: 87,460,579	M633K	possibly damaging	Het
Vars2	A	G	17: 35,660,061	W626R	probably damaging	Het
Vmn2r10	A	T	5: 109,006,254	Y61*	probably null	Het
Vmn2r95	T	C	17: 18,451,543	V514A	probably benign	Het
Vwa5a	T	G	9: 38,737,814		probably benign	Het
Zfp365	A	T	10: 67,909,856	C31S	probably damaging	Het
Zfp397	A	T	18: 23,960,051	I198F	possibly damaging	Het
Zfp407	C	T	18: 84,559,773	A1072T	probably benign	Het
Zfp593	T	C	4: 134,244,895	E100G	possibly damaging	Het

Other mutations in Adamts9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00565:Adamts9	APN	6	92859902	missense	possibly damaging	0.90
IGL01352:Adamts9	APN	6	92860174	missense	probably benign	0.00
IGL01462:Adamts9	APN	6	92894266	missense	probably benign	0.04
IGL01551:Adamts9	APN	6	92807020	missense	probably damaging	0.99
IGL01577:Adamts9	APN	6	92858147	splice site	probably benign
IGL01638:Adamts9	APN	6	92872428	missense	probably benign	0.19
IGL01757:Adamts9	APN	6	92796159	missense	probably damaging	1.00
IGL02102:Adamts9	APN	6	92777439	missense	probably benign	0.00
IGL02379:Adamts9	APN	6	92797033	missense	probably damaging	0.97
IGL02419:Adamts9	APN	6	92796997	missense	probably benign	0.04
IGL02554:Adamts9	APN	6	92880847	missense	probably benign	0.01
IGL02832:Adamts9	APN	6	92807175	missense	probably damaging	1.00
IGL03164:Adamts9	APN	6	92889937	missense	probably damaging	1.00
IGL03347:Adamts9	APN	6	92887432	nonsense	probably null
IGL03401:Adamts9	APN	6	92786868	missense	probably damaging	0.97
basilisk	UTSW	6	92860189	missense	probably benign	0.35
bluebeard	UTSW	6	92879959	nonsense	probably null
Serpent	UTSW	6	92908706	missense	probably damaging	1.00
PIT4402001:Adamts9	UTSW	6	92872347	missense	probably benign
PIT4458001:Adamts9	UTSW	6	92889905	missense	probably damaging	0.99
R0047:Adamts9	UTSW	6	92905306	unclassified	probably benign
R0047:Adamts9	UTSW	6	92905306	unclassified	probably benign
R0067:Adamts9	UTSW	6	92890167	missense	probably damaging	0.98
R0141:Adamts9	UTSW	6	92943085	missense	probably benign
R0326:Adamts9	UTSW	6	92858057	nonsense	probably null
R0396:Adamts9	UTSW	6	92798005	missense	probably benign	0.00
R0490:Adamts9	UTSW	6	92872866	missense	probably benign
R0504:Adamts9	UTSW	6	92912645	missense	probably damaging	1.00
R0620:Adamts9	UTSW	6	92858113	missense	possibly damaging	0.95
R0669:Adamts9	UTSW	6	92880957	missense	probably damaging	1.00
R0682:Adamts9	UTSW	6	92903802	missense	possibly damaging	0.80
R1412:Adamts9	UTSW	6	92796433	missense	probably benign
R1433:Adamts9	UTSW	6	92849290	critical splice donor site	probably null
R1558:Adamts9	UTSW	6	92908711	missense	possibly damaging	0.87
R1661:Adamts9	UTSW	6	92880623	missense	possibly damaging	0.92
R1801:Adamts9	UTSW	6	92863376	missense	probably benign	0.27
R1855:Adamts9	UTSW	6	92901369	splice site	probably benign
R1887:Adamts9	UTSW	6	92872788	critical splice donor site	probably null
R1934:Adamts9	UTSW	6	92943121	missense	possibly damaging	0.59
R1956:Adamts9	UTSW	6	92859849	missense	probably damaging	1.00
R2370:Adamts9	UTSW	6	92860203	missense	probably damaging	0.99
R2376:Adamts9	UTSW	6	92912831	missense	probably benign
R2432:Adamts9	UTSW	6	92857900	missense	probably damaging	1.00
R2876:Adamts9	UTSW	6	92795910	splice site	probably benign
R3015:Adamts9	UTSW	6	92872932	missense	probably benign	0.05
R3611:Adamts9	UTSW	6	92869984	missense	probably benign	0.05
R4024:Adamts9	UTSW	6	92872784	splice site	probably benign
R4292:Adamts9	UTSW	6	92795996	missense	possibly damaging	0.95
R4403:Adamts9	UTSW	6	92859864	missense	probably damaging	1.00
R4574:Adamts9	UTSW	6	92879959	nonsense	probably null
R4677:Adamts9	UTSW	6	92816606	start codon destroyed	probably null
R5114:Adamts9	UTSW	6	92890273	missense	probably benign	0.03
R5260:Adamts9	UTSW	6	92807137	missense	probably benign	0.00
R5384:Adamts9	UTSW	6	92798018	missense	probably damaging	1.00
R5423:Adamts9	UTSW	6	92880697	missense	possibly damaging	0.84
R5497:Adamts9	UTSW	6	92854365	missense	probably damaging	1.00
R5629:Adamts9	UTSW	6	92798133	missense	probably damaging	1.00
R5943:Adamts9	UTSW	6	92903786	missense	probably benign	0.02
R6039:Adamts9	UTSW	6	92908546	missense	possibly damaging	0.95
R6039:Adamts9	UTSW	6	92908546	missense	possibly damaging	0.95
R6051:Adamts9	UTSW	6	92859926	missense	possibly damaging	0.83
R6051:Adamts9	UTSW	6	92890118	missense	probably damaging	1.00
R6082:Adamts9	UTSW	6	92889949	missense	probably damaging	1.00
R6192:Adamts9	UTSW	6	92797021	missense	probably damaging	1.00
R6291:Adamts9	UTSW	6	92890120	missense	probably damaging	1.00
R6502:Adamts9	UTSW	6	92872335	missense	probably damaging	1.00
R6818:Adamts9	UTSW	6	92905191	missense	probably damaging	1.00
R6848:Adamts9	UTSW	6	92863354	missense	possibly damaging	0.84
R7028:Adamts9	UTSW	6	92909793	nonsense	probably null
R7095:Adamts9	UTSW	6	92887691	missense	probably benign	0.39
R7287:Adamts9	UTSW	6	92890003	missense	possibly damaging	0.89
R7294:Adamts9	UTSW	6	92894289	missense	probably damaging	1.00
R7313:Adamts9	UTSW	6	92858121	missense	probably damaging	1.00
R7581:Adamts9	UTSW	6	92937338	missense	probably benign	0.00
R7682:Adamts9	UTSW	6	92880698	missense	possibly damaging	0.57
R7691:Adamts9	UTSW	6	92796238	missense	probably damaging	1.00
R7791:Adamts9	UTSW	6	92872385	missense	probably benign	0.00
R7851:Adamts9	UTSW	6	92908706	missense	probably damaging	1.00
R7974:Adamts9	UTSW	6	92909687	critical splice donor site	probably null
R8224:Adamts9	UTSW	6	92796370	missense	probably damaging	0.96
R8328:Adamts9	UTSW	6	92890012	missense	probably benign	0.17
R8334:Adamts9	UTSW	6	92937244	splice site	probably null
R8559:Adamts9	UTSW	6	92807136	missense	probably benign	0.01
R8709:Adamts9	UTSW	6	92807163	missense	probably damaging	1.00
R8735:Adamts9	UTSW	6	92860067	intron	probably benign
R8739:Adamts9	UTSW	6	92854280	missense	probably benign	0.04
R9108:Adamts9	UTSW	6	92880740	missense	probably damaging	1.00
R9171:Adamts9	UTSW	6	92872400	missense	probably benign	0.03
R9198:Adamts9	UTSW	6	92860189	missense	probably benign	0.35
R9299:Adamts9	UTSW	6	92796995	missense	probably benign	0.00
R9300:Adamts9	UTSW	6	92887390	missense	probably benign	0.10
R9308:Adamts9	UTSW	6	92880894	missense	probably benign	0.03
R9325:Adamts9	UTSW	6	92872298	missense	probably benign	0.00
R9397:Adamts9	UTSW	6	92901463	missense	probably damaging	1.00
R9550:Adamts9	UTSW	6	92901448	missense	probably benign	0.00
R9623:Adamts9	UTSW	6	92880680	missense	probably benign	0.02
R9698:Adamts9	UTSW	6	92807140	missense	probably damaging	1.00
R9755:Adamts9	UTSW	6	92879941	missense	probably benign	0.15
RF013:Adamts9	UTSW	6	92943145	missense	possibly damaging	0.88
Z1177:Adamts9	UTSW	6	92854346	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCAGAATTCATCCCTGCACAG -3'
(R):5'- CGCACTTGTATGCTCAAGGT -3'

Sequencing Primer
(F):5'- GAATTCATCCCTGCACAGAATAC -3'
(R):5'- CCTGTTGAGACAAAGTTGCC -3'

Posted On

2014-08-25