Incidental Mutation 'R0137:Nckap1l'
ID22065
Institutional Source Beutler Lab
Gene Symbol Nckap1l
Ensembl Gene ENSMUSG00000022488
Gene NameNCK associated protein 1 like
SynonymsHem1, 4930568P13Rik
MMRRC Submission 038422-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.868) question?
Stock #R0137 (G1)
Quality Score191
Status Validated (trace)
Chromosome15
Chromosomal Location103453794-103498810 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103481964 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 721 (I721F)
Ref Sequence ENSEMBL: ENSMUSP00000035400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047405] [ENSMUST00000229127]
Predicted Effect probably benign
Transcript: ENSMUST00000047405
AA Change: I721F

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000035400
Gene: ENSMUSG00000022488
AA Change: I721F

DomainStartEndE-ValueType
Pfam:Nckap1 7 1123 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229127
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229835
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230276
Meta Mutation Damage Score 0.1018 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.8%
Validation Efficiency 95% (94/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the HEM family of tissue-specific transmembrane proteins which are highly conserved from invertebrates through mammals. This gene is only expressed in hematopoietic cells. The encoded protein is a part of the Scar/WAVE complex which plays an important role in regulating cell shape in both metazoans and plants. Alternatively spliced transcript variants encoding different isoforms have been found.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit anemia, lymphopenia, neutrophilia and tissue-specific pathology, defective neutrophil migration, phagocytosis and F-actin polymerization, abnormal B and T cell development, impaired T cell activation and adhesion, and enhanced IL-17 production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700092M07Rik A G 19: 8,740,857 probably benign Het
4931406P16Rik A T 7: 34,239,219 W246R probably damaging Het
6430548M08Rik A T 8: 120,151,376 H190L possibly damaging Het
Adap1 A G 5: 139,293,221 probably benign Het
Adgra3 C T 5: 49,963,840 probably benign Het
Adgre5 A T 8: 83,724,898 V527E probably damaging Het
Anapc5 A T 5: 122,800,632 Y360N probably damaging Het
Angptl6 C A 9: 20,878,387 A70S probably benign Het
Ankdd1a C A 9: 65,510,328 K137N probably null Het
Ccdc170 T C 10: 4,546,950 probably benign Het
Ccdc51 A G 9: 109,091,630 E195G probably damaging Het
Cdc37 A T 9: 21,142,130 C204S possibly damaging Het
Cfap36 T C 11: 29,222,431 probably benign Het
Col6a2 C A 10: 76,596,425 G965C probably damaging Het
Csn1s2a G A 5: 87,778,967 S53N possibly damaging Het
Dab2ip T C 2: 35,692,376 probably null Het
Dhx58 A G 11: 100,696,997 V578A probably damaging Het
Diaph1 G T 18: 37,891,849 Q520K unknown Het
Eefsec C A 6: 88,297,649 K444N probably benign Het
Eftud2 A T 11: 102,868,617 H153Q possibly damaging Het
Eif5b T G 1: 38,019,243 S209A probably benign Het
Exosc2 T A 2: 31,672,485 Y46N probably damaging Het
F2 C T 2: 91,625,730 G562D probably damaging Het
Fgf23 G A 6: 127,080,165 G148D probably damaging Het
Fmnl3 G C 15: 99,322,738 probably benign Het
Fstl5 G A 3: 76,707,479 G179R probably damaging Het
Gart T A 16: 91,625,394 Q745L probably benign Het
Gmeb1 T A 4: 132,232,108 M212L probably benign Het
Gpaa1 T C 15: 76,334,781 Y548H probably damaging Het
Gpatch1 T C 7: 35,287,242 E763G probably damaging Het
Grm8 T A 6: 27,762,390 I279F probably damaging Het
Hcls1 T A 16: 36,951,174 H147Q probably damaging Het
Hpcal1 A C 12: 17,786,388 D73A probably damaging Het
Il22ra1 T C 4: 135,751,006 S463P probably benign Het
Itgbl1 G A 14: 123,840,686 probably null Het
Izumo3 G T 4: 92,147,200 probably benign Het
Kcna5 A T 6: 126,533,383 L594Q probably damaging Het
Kif13a A T 13: 46,764,603 D409E probably benign Het
Kif9 A T 9: 110,485,038 I39F probably damaging Het
Klri2 C T 6: 129,732,208 R227H possibly damaging Het
Lamc3 G A 2: 31,908,616 G445S probably damaging Het
Lctl A G 9: 64,117,698 probably benign Het
Lrp4 T C 2: 91,494,982 L1384P probably damaging Het
Mcm9 G A 10: 53,563,430 S549L possibly damaging Het
Ms4a15 G A 19: 10,979,333 probably benign Het
Mtor T C 4: 148,470,624 V901A possibly damaging Het
Nemp2 T C 1: 52,645,429 V298A probably benign Het
Npc1l1 T A 11: 6,228,148 K421* probably null Het
Npr1 C T 3: 90,455,937 V879M probably damaging Het
Olfr1368 A G 13: 21,142,166 V297A possibly damaging Het
Olfr638 A G 7: 104,003,502 T82A probably benign Het
Osgin1 A T 8: 119,442,480 I39F possibly damaging Het
Phip G C 9: 82,927,191 probably null Het
Pkdrej G T 15: 85,821,567 P56Q possibly damaging Het
Plcxd2 A G 16: 45,980,526 Y112H probably damaging Het
Plekha1 C T 7: 130,897,446 T155M probably damaging Het
Prkdc T C 16: 15,740,332 probably null Het
Prss1 A G 6: 41,462,561 H76R probably damaging Het
Psg23 T C 7: 18,614,633 D83G probably benign Het
Ptprd T A 4: 76,136,903 Q196L probably benign Het
Ranbp3l A T 15: 9,062,987 H292L probably damaging Het
Ranbp6 T C 19: 29,809,697 E1085G probably benign Het
Rccd1 A G 7: 80,320,578 V97A possibly damaging Het
Rchy1 T C 5: 91,957,599 S48G probably benign Het
Rnmt G A 18: 68,313,700 M265I probably benign Het
Robo3 A T 9: 37,425,344 M376K probably benign Het
Rrp12 T C 19: 41,873,850 D898G probably benign Het
Scg3 A T 9: 75,663,180 probably benign Het
Sec31b A T 19: 44,534,382 M57K probably damaging Het
Slc17a6 A C 7: 51,666,144 I387L probably benign Het
Speer4a T A 5: 26,035,984 Q170L possibly damaging Het
Srsf9 A G 5: 115,332,201 D146G possibly damaging Het
Ss18 A G 18: 14,655,143 M90T probably damaging Het
Syna A T 5: 134,559,460 F212I possibly damaging Het
Thsd1 A G 8: 22,243,039 H34R probably damaging Het
Tmem143 T C 7: 45,897,662 I84T probably benign Het
Trim50 T C 5: 135,366,633 V281A probably damaging Het
Trp53i11 C A 2: 93,199,351 probably benign Het
Ttc25 A G 11: 100,563,568 E393G probably damaging Het
Ttll4 C T 1: 74,679,692 T234I possibly damaging Het
Ttyh1 A T 7: 4,124,720 I136F possibly damaging Het
Ube2f T C 1: 91,262,254 probably benign Het
Vcl T A 14: 20,987,015 L227* probably null Het
Vmn1r222 A C 13: 23,232,804 C80G probably damaging Het
Vps13b G T 15: 35,926,219 A3889S probably benign Het
Vps8 T C 16: 21,504,386 probably benign Het
Zbtb44 A G 9: 31,066,710 Y422C probably damaging Het
Zfp180 A G 7: 24,105,733 S526G possibly damaging Het
Zfp518a A C 19: 40,915,866 E1413A probably damaging Het
Zfp629 T A 7: 127,611,686 Y317F probably damaging Het
Zfp804b T C 5: 6,770,534 E843G probably benign Het
Other mutations in Nckap1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Nckap1l APN 15 103462720 missense probably benign 0.42
IGL01818:Nckap1l APN 15 103478282 missense probably damaging 1.00
IGL01912:Nckap1l APN 15 103474146 missense probably benign 0.15
IGL01945:Nckap1l APN 15 103461642 missense probably damaging 1.00
IGL01947:Nckap1l APN 15 103491015 missense probably benign 0.32
IGL02218:Nckap1l APN 15 103483527 missense possibly damaging 0.47
IGL02317:Nckap1l APN 15 103461578 missense probably benign 0.05
IGL02376:Nckap1l APN 15 103471231 missense possibly damaging 0.95
IGL03263:Nckap1l APN 15 103464405 missense probably damaging 1.00
hem-haw UTSW 15 103471232 nonsense probably null
Sinstral UTSW 15 103483613 missense probably benign
stammer UTSW 15 103473821 missense possibly damaging 0.79
stutter UTSW 15 103476099 critical splice donor site probably null
tentative UTSW 15 103474159 missense probably damaging 0.98
IGL02802:Nckap1l UTSW 15 103464536 missense probably benign 0.03
R0016:Nckap1l UTSW 15 103475636 missense probably benign
R0016:Nckap1l UTSW 15 103475636 missense probably benign
R0114:Nckap1l UTSW 15 103455028 missense probably benign
R0375:Nckap1l UTSW 15 103474159 missense probably damaging 0.98
R0390:Nckap1l UTSW 15 103453883 missense probably damaging 1.00
R0412:Nckap1l UTSW 15 103464652 missense probably benign 0.01
R0467:Nckap1l UTSW 15 103497427 missense probably benign 0.02
R1245:Nckap1l UTSW 15 103455925 missense probably damaging 1.00
R1592:Nckap1l UTSW 15 103482180 critical splice donor site probably null
R1593:Nckap1l UTSW 15 103478854 missense probably null 0.00
R1879:Nckap1l UTSW 15 103464601 missense probably benign
R2081:Nckap1l UTSW 15 103497454 missense probably damaging 0.98
R2144:Nckap1l UTSW 15 103475676 missense probably damaging 0.96
R2228:Nckap1l UTSW 15 103455934 critical splice donor site probably null
R2229:Nckap1l UTSW 15 103455934 critical splice donor site probably null
R2411:Nckap1l UTSW 15 103483568 missense probably damaging 1.00
R3965:Nckap1l UTSW 15 103464589 nonsense probably null
R3971:Nckap1l UTSW 15 103462560 missense probably damaging 1.00
R4270:Nckap1l UTSW 15 103473122 missense possibly damaging 0.96
R4348:Nckap1l UTSW 15 103486819 missense probably damaging 0.99
R4351:Nckap1l UTSW 15 103486819 missense probably damaging 0.99
R4748:Nckap1l UTSW 15 103473056 missense probably damaging 1.00
R4918:Nckap1l UTSW 15 103483613 missense probably benign
R5230:Nckap1l UTSW 15 103483639 missense probably benign 0.30
R5595:Nckap1l UTSW 15 103475658 missense possibly damaging 0.57
R5642:Nckap1l UTSW 15 103455025 missense probably benign 0.00
R5701:Nckap1l UTSW 15 103472768 missense probably benign 0.34
R6000:Nckap1l UTSW 15 103478815 missense probably benign 0.07
R6229:Nckap1l UTSW 15 103473122 missense possibly damaging 0.96
R6367:Nckap1l UTSW 15 103475722 missense probably benign 0.00
R6420:Nckap1l UTSW 15 103491466 missense possibly damaging 0.89
R6440:Nckap1l UTSW 15 103471232 nonsense probably null
R6957:Nckap1l UTSW 15 103491511 missense possibly damaging 0.91
R7023:Nckap1l UTSW 15 103476066 missense probably benign 0.11
R7083:Nckap1l UTSW 15 103482124 missense probably damaging 1.00
R7360:Nckap1l UTSW 15 103476099 critical splice donor site probably null
R7361:Nckap1l UTSW 15 103471282 missense possibly damaging 0.79
R7457:Nckap1l UTSW 15 103453806 start gained probably benign
R7582:Nckap1l UTSW 15 103482160 missense probably damaging 1.00
R7662:Nckap1l UTSW 15 103462585 missense probably damaging 0.99
R7699:Nckap1l UTSW 15 103462821 splice site probably null
R7951:Nckap1l UTSW 15 103473115 missense probably damaging 1.00
R8059:Nckap1l UTSW 15 103493287 missense possibly damaging 0.87
R8124:Nckap1l UTSW 15 103473821 missense possibly damaging 0.79
R8152:Nckap1l UTSW 15 103478530 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCCATTCTTGGCAGAAGTTGGGAC -3'
(R):5'- AGGAGGGCATTGCGAACGATTC -3'

Sequencing Primer
(F):5'- gaatcaaatgtcaatggacacaag -3'
(R):5'- TCTGGAAGCATCTGCACC -3'
Posted On2013-04-12