Incidental Mutation 'R1986:Hephl1'
ID220665
Institutional Source Beutler Lab
Gene Symbol Hephl1
Ensembl Gene ENSMUSG00000031936
Gene Namehephaestin-like 1
SynonymsLOC244698, zyklopen, Zp
MMRRC Submission 039998-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R1986 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location15051841-15112108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 15054552 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 1035 (E1035A)
Ref Sequence ENSEMBL: ENSMUSP00000124518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159985]
Predicted Effect probably damaging
Transcript: ENSMUST00000159985
AA Change: E1035A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124518
Gene: ENSMUSG00000031936
AA Change: E1035A

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
Pfam:Cu-oxidase_3 97 209 2.8e-12 PFAM
Pfam:Cu-oxidase_2 289 365 2.4e-9 PFAM
Pfam:Cu-oxidase_3 452 564 1.2e-9 PFAM
Blast:FA58C 604 703 9e-9 BLAST
Pfam:Cu-oxidase_3 805 908 1.6e-7 PFAM
Pfam:Cu-oxidase_2 946 1067 9e-14 PFAM
transmembrane domain 1115 1137 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,419,328 S105P probably damaging Het
2610507B11Rik A T 11: 78,274,612 H1318L probably damaging Het
9930111J21Rik2 T A 11: 49,019,292 K771N possibly damaging Het
Abcc2 A G 19: 43,829,879 E1268G probably damaging Het
Adamts4 T C 1: 171,256,675 F574L possibly damaging Het
Adamts9 A G 6: 92,796,394 V1165A probably benign Het
Agap2 A T 10: 127,083,044 K430* probably null Het
Amn G T 12: 111,274,997 G232V probably damaging Het
Ank3 A G 10: 69,867,428 E297G probably damaging Het
Arhgap45 T C 10: 80,020,696 L26P probably damaging Het
Atp10b C A 11: 43,172,768 Q177K probably benign Het
Bbs10 A T 10: 111,299,257 D77V probably damaging Het
Bpifa1 T A 2: 154,144,336 L127Q probably damaging Het
Brinp2 T C 1: 158,246,778 N591S probably damaging Het
C2cd2 A C 16: 97,870,271 V476G probably damaging Het
C7 T A 15: 5,012,012 T471S possibly damaging Het
Cacna1b A T 2: 24,648,986 Y1488N probably damaging Het
Cadps2 A G 6: 23,323,380 F1001L probably damaging Het
Ccdc188 T C 16: 18,218,843 S216P probably damaging Het
Ccdc24 A G 4: 117,872,016 L88P probably damaging Het
Dab1 T C 4: 104,613,215 I65T probably damaging Het
Dock4 A T 12: 40,730,063 D621V probably damaging Het
Drd5 A T 5: 38,320,113 M150L probably damaging Het
Eef2k T A 7: 120,873,346 M94K possibly damaging Het
Epg5 A G 18: 77,982,306 probably null Het
Epsti1 T C 14: 77,932,233 probably null Het
Ern2 T A 7: 122,171,529 D754V probably benign Het
Fam129c T A 8: 71,603,760 I368N possibly damaging Het
Fbxo6 A G 4: 148,146,095 Y237H probably damaging Het
Fbxw24 A G 9: 109,607,056 S303P probably damaging Het
Fpr-rs3 A T 17: 20,623,841 probably null Het
Gab1 G T 8: 80,766,381 T679K probably damaging Het
Gbp9 C A 5: 105,105,724 V42F probably damaging Het
Gbp9 A T 5: 105,105,786 V21E probably damaging Het
Gm14085 A G 2: 122,527,429 T655A probably benign Het
Gm20821 A G Y: 9,783,927 Q183R probably benign Het
Gpatch11 A T 17: 78,843,837 I226F probably benign Het
Hspa4l T C 3: 40,760,401 V156A probably damaging Het
Ifna13 A G 4: 88,644,351 V12A probably benign Het
Il24 G A 1: 130,882,531 T196I probably benign Het
Irgm2 A G 11: 58,219,558 D37G probably benign Het
Irs1 A G 1: 82,288,765 S577P probably damaging Het
Kif21b G A 1: 136,147,546 D166N probably damaging Het
Krtap4-16 T C 11: 99,851,496 Q26R unknown Het
Lig1 T A 7: 13,309,142 Y837* probably null Het
Lrrc69 T C 4: 14,708,669 E225G possibly damaging Het
Map3k20 C T 2: 72,441,294 Q589* probably null Het
Masp1 T G 16: 23,483,461 M347L probably benign Het
Mgat3 A T 15: 80,212,189 I406F probably benign Het
Mmp1b T G 9: 7,368,577 D425A probably benign Het
Mss51 T C 14: 20,483,191 H404R probably benign Het
Myo15b A T 11: 115,882,875 H1911L probably benign Het
Nedd4l A G 18: 65,143,803 D102G probably damaging Het
Npc2 T C 12: 84,760,749 K112E probably benign Het
Nuggc T A 14: 65,641,921 V694E probably damaging Het
Olfm1 T G 2: 28,214,706 V157G probably benign Het
Olfr476 T C 7: 107,967,670 V91A probably benign Het
Olfr63 T C 17: 33,269,515 S264P probably benign Het
Otogl T A 10: 107,794,190 probably null Het
Ovgp1 G A 3: 105,974,935 C38Y probably damaging Het
Pisd A T 5: 32,737,328 S344T probably damaging Het
Psme4 T C 11: 30,830,352 V840A probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rims2 T A 15: 39,345,314 M171K probably damaging Het
Rin2 T A 2: 145,878,940 M731K probably damaging Het
Scgb1b19 T C 7: 33,287,683 probably null Het
Serpina10 A G 12: 103,628,255 I235T possibly damaging Het
Setbp1 T A 18: 78,858,544 E636V probably damaging Het
Sh3d21 C T 4: 126,162,497 E101K probably damaging Het
Ski T G 4: 155,221,691 D225A probably damaging Het
Slc29a3 T C 10: 60,723,814 Y187C probably damaging Het
Sort1 T A 3: 108,345,727 D494E possibly damaging Het
Sphkap A T 1: 83,277,922 L702Q probably damaging Het
Srr A G 11: 74,908,719 I285T probably damaging Het
Stam2 T C 2: 52,709,626 T257A possibly damaging Het
Suds3 A T 5: 117,108,352 N112K probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tesk2 T C 4: 116,751,193 L104P probably damaging Het
Tie1 C T 4: 118,478,963 R702H probably benign Het
Tpo G T 12: 30,119,466 A90E probably damaging Het
Trim30a T C 7: 104,411,465 D368G probably damaging Het
Ugt2a2 A T 5: 87,460,579 M633K possibly damaging Het
Vars2 A G 17: 35,660,061 W626R probably damaging Het
Vmn2r10 A T 5: 109,006,254 Y61* probably null Het
Vmn2r95 T C 17: 18,451,543 V514A probably benign Het
Vwa5a T G 9: 38,737,814 probably benign Het
Zfp365 A T 10: 67,909,856 C31S probably damaging Het
Zfp397 A T 18: 23,960,051 I198F possibly damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp593 T C 4: 134,244,895 E100G possibly damaging Het
Other mutations in Hephl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Hephl1 APN 9 15067045 missense probably benign 0.06
IGL01105:Hephl1 APN 9 15089024 missense possibly damaging 0.95
IGL01731:Hephl1 APN 9 15069770 missense probably damaging 1.00
IGL02010:Hephl1 APN 9 15090556 nonsense probably null
IGL02112:Hephl1 APN 9 15081815 splice site probably benign
IGL02227:Hephl1 APN 9 15069793 missense probably damaging 1.00
IGL02490:Hephl1 APN 9 15053685 missense probably benign 0.06
IGL02960:Hephl1 APN 9 15084319 missense probably damaging 1.00
IGL03265:Hephl1 APN 9 15060959 missense probably benign 0.14
R0006:Hephl1 UTSW 9 15076764 missense probably benign 0.16
R0006:Hephl1 UTSW 9 15076764 missense probably benign 0.16
R0007:Hephl1 UTSW 9 15086175 missense possibly damaging 0.58
R0092:Hephl1 UTSW 9 15090603 frame shift probably null
R0421:Hephl1 UTSW 9 15059160 missense probably benign 0.05
R0448:Hephl1 UTSW 9 15076926 missense probably damaging 1.00
R0563:Hephl1 UTSW 9 15081945 missense probably damaging 1.00
R0602:Hephl1 UTSW 9 15089051 missense probably damaging 0.99
R0631:Hephl1 UTSW 9 15084524 missense probably benign 0.04
R0747:Hephl1 UTSW 9 15054001 splice site probably benign
R1123:Hephl1 UTSW 9 15080140 missense probably benign 0.00
R1386:Hephl1 UTSW 9 15076754 missense probably benign
R1711:Hephl1 UTSW 9 15059246 missense probably damaging 1.00
R1743:Hephl1 UTSW 9 15090068 missense probably damaging 0.99
R1833:Hephl1 UTSW 9 15076928 missense probably damaging 0.99
R1908:Hephl1 UTSW 9 15074124 nonsense probably null
R1918:Hephl1 UTSW 9 15076818 missense probably benign 0.16
R1938:Hephl1 UTSW 9 15053987 missense possibly damaging 0.88
R3122:Hephl1 UTSW 9 15088969 missense possibly damaging 0.90
R3832:Hephl1 UTSW 9 15069748 missense probably damaging 1.00
R3833:Hephl1 UTSW 9 15069748 missense probably damaging 1.00
R4280:Hephl1 UTSW 9 15112034 missense probably benign 0.05
R4434:Hephl1 UTSW 9 15076796 missense probably damaging 0.99
R4790:Hephl1 UTSW 9 15059171 missense probably damaging 1.00
R4793:Hephl1 UTSW 9 15097990 missense probably benign 0.34
R4960:Hephl1 UTSW 9 15086290 missense probably damaging 1.00
R5125:Hephl1 UTSW 9 15086172 missense probably damaging 0.98
R5152:Hephl1 UTSW 9 15080185 missense probably damaging 1.00
R5178:Hephl1 UTSW 9 15086172 missense probably damaging 0.98
R5288:Hephl1 UTSW 9 15076854 missense possibly damaging 0.83
R5372:Hephl1 UTSW 9 15097899 nonsense probably null
R5377:Hephl1 UTSW 9 15069788 missense probably damaging 1.00
R5788:Hephl1 UTSW 9 15084283 missense possibly damaging 0.93
R5795:Hephl1 UTSW 9 15069760 missense probably damaging 0.99
R6210:Hephl1 UTSW 9 15090564 missense possibly damaging 0.57
R6303:Hephl1 UTSW 9 15090152 missense possibly damaging 0.69
R6394:Hephl1 UTSW 9 15074101 missense probably benign 0.00
R6653:Hephl1 UTSW 9 15081964 missense probably damaging 0.99
R6764:Hephl1 UTSW 9 15088921 missense possibly damaging 0.88
R7114:Hephl1 UTSW 9 15069815 missense probably damaging 0.96
R7143:Hephl1 UTSW 9 15060810 missense possibly damaging 0.80
R7404:Hephl1 UTSW 9 15069751 missense possibly damaging 0.84
R7446:Hephl1 UTSW 9 15098051 missense probably damaging 1.00
R7447:Hephl1 UTSW 9 15097882 critical splice donor site probably null
R7715:Hephl1 UTSW 9 15060785 missense probably benign 0.36
X0026:Hephl1 UTSW 9 15084228 critical splice donor site probably null
X0066:Hephl1 UTSW 9 15053668 missense probably benign 0.00
Z1088:Hephl1 UTSW 9 15053721 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCACATATCCACGCATCTGTC -3'
(R):5'- TTGAGGCCATTGGAGACAGTG -3'

Sequencing Primer
(F):5'- CACTTGACTCTGAGCCCG -3'
(R):5'- GTGGTCACTGCAAGTTTATCAAAGTG -3'
Posted On2014-08-25