Mutagenetix > Incidental Mutation

Incidental Mutation 'R1986:Psme4'

220689

Institutional Source

Beutler Lab

Gene Symbol

Psme4

Ensembl Gene

ENSMUSG00000040850

Gene Name

proteasome (prosome, macropain) activator subunit 4

Synonyms

MMRRC Submission

039998-MU

Accession Numbers

Genbank: NM_134013

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1986 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30771726-30880361 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 30830352 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 840 (V840A)

Ref Sequence

ENSEMBL: ENSMUSP00000045460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041231]

AlphaFold

Q5SSW2

Predicted Effect

probably benign
Transcript: ENSMUST00000041231
AA Change: V840A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: V840A

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	122	133	N/A	INTRINSIC
Pfam:BLM10_mid	330	828	8.8e-119	PFAM
SCOP:d1b3ua_	1183	1716	3e-14	SMART
Pfam:DUF3437	1756	1843	5.3e-39	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142217

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150219

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.7%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	G	3: 124,419,328	S105P	probably damaging	Het
2610507B11Rik	A	T	11: 78,274,612	H1318L	probably damaging	Het
9930111J21Rik2	T	A	11: 49,019,292	K771N	possibly damaging	Het
Abcc2	A	G	19: 43,829,879	E1268G	probably damaging	Het
Adamts4	T	C	1: 171,256,675	F574L	possibly damaging	Het
Adamts9	A	G	6: 92,796,394	V1165A	probably benign	Het
Agap2	A	T	10: 127,083,044	K430*	probably null	Het
Amn	G	T	12: 111,274,997	G232V	probably damaging	Het
Ank3	A	G	10: 69,867,428	E297G	probably damaging	Het
Arhgap45	T	C	10: 80,020,696	L26P	probably damaging	Het
Atp10b	C	A	11: 43,172,768	Q177K	probably benign	Het
Bbs10	A	T	10: 111,299,257	D77V	probably damaging	Het
Bpifa1	T	A	2: 154,144,336	L127Q	probably damaging	Het
Brinp2	T	C	1: 158,246,778	N591S	probably damaging	Het
C2cd2	A	C	16: 97,870,271	V476G	probably damaging	Het
C7	T	A	15: 5,012,012	T471S	possibly damaging	Het
Cacna1b	A	T	2: 24,648,986	Y1488N	probably damaging	Het
Cadps2	A	G	6: 23,323,380	F1001L	probably damaging	Het
Ccdc188	T	C	16: 18,218,843	S216P	probably damaging	Het
Ccdc24	A	G	4: 117,872,016	L88P	probably damaging	Het
Dab1	T	C	4: 104,613,215	I65T	probably damaging	Het
Dock4	A	T	12: 40,730,063	D621V	probably damaging	Het
Drd5	A	T	5: 38,320,113	M150L	probably damaging	Het
Eef2k	T	A	7: 120,873,346	M94K	possibly damaging	Het
Epg5	A	G	18: 77,982,306		probably null	Het
Epsti1	T	C	14: 77,932,233		probably null	Het
Ern2	T	A	7: 122,171,529	D754V	probably benign	Het
Fam129c	T	A	8: 71,603,760	I368N	possibly damaging	Het
Fbxo6	A	G	4: 148,146,095	Y237H	probably damaging	Het
Fbxw24	A	G	9: 109,607,056	S303P	probably damaging	Het
Fpr-rs3	A	T	17: 20,623,841		probably null	Het
Gab1	G	T	8: 80,766,381	T679K	probably damaging	Het
Gbp9	C	A	5: 105,105,724	V42F	probably damaging	Het
Gbp9	A	T	5: 105,105,786	V21E	probably damaging	Het
Gm14085	A	G	2: 122,527,429	T655A	probably benign	Het
Gm20821	A	G	Y: 9,783,927	Q183R	probably benign	Het
Gpatch11	A	T	17: 78,843,837	I226F	probably benign	Het
Hephl1	T	G	9: 15,054,552	E1035A	probably damaging	Het
Hspa4l	T	C	3: 40,760,401	V156A	probably damaging	Het
Ifna13	A	G	4: 88,644,351	V12A	probably benign	Het
Il24	G	A	1: 130,882,531	T196I	probably benign	Het
Irgm2	A	G	11: 58,219,558	D37G	probably benign	Het
Irs1	A	G	1: 82,288,765	S577P	probably damaging	Het
Kif21b	G	A	1: 136,147,546	D166N	probably damaging	Het
Krtap4-16	T	C	11: 99,851,496	Q26R	unknown	Het
Lig1	T	A	7: 13,309,142	Y837*	probably null	Het
Lrrc69	T	C	4: 14,708,669	E225G	possibly damaging	Het
Map3k20	C	T	2: 72,441,294	Q589*	probably null	Het
Masp1	T	G	16: 23,483,461	M347L	probably benign	Het
Mgat3	A	T	15: 80,212,189	I406F	probably benign	Het
Mmp1b	T	G	9: 7,368,577	D425A	probably benign	Het
Mss51	T	C	14: 20,483,191	H404R	probably benign	Het
Myo15b	A	T	11: 115,882,875	H1911L	probably benign	Het
Nedd4l	A	G	18: 65,143,803	D102G	probably damaging	Het
Npc2	T	C	12: 84,760,749	K112E	probably benign	Het
Nuggc	T	A	14: 65,641,921	V694E	probably damaging	Het
Olfm1	T	G	2: 28,214,706	V157G	probably benign	Het
Olfr476	T	C	7: 107,967,670	V91A	probably benign	Het
Olfr63	T	C	17: 33,269,515	S264P	probably benign	Het
Otogl	T	A	10: 107,794,190		probably null	Het
Ovgp1	G	A	3: 105,974,935	C38Y	probably damaging	Het
Pisd	A	T	5: 32,737,328	S344T	probably damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Rims2	T	A	15: 39,345,314	M171K	probably damaging	Het
Rin2	T	A	2: 145,878,940	M731K	probably damaging	Het
Scgb1b19	T	C	7: 33,287,683		probably null	Het
Serpina10	A	G	12: 103,628,255	I235T	possibly damaging	Het
Setbp1	T	A	18: 78,858,544	E636V	probably damaging	Het
Sh3d21	C	T	4: 126,162,497	E101K	probably damaging	Het
Ski	T	G	4: 155,221,691	D225A	probably damaging	Het
Slc29a3	T	C	10: 60,723,814	Y187C	probably damaging	Het
Sort1	T	A	3: 108,345,727	D494E	possibly damaging	Het
Sphkap	A	T	1: 83,277,922	L702Q	probably damaging	Het
Srr	A	G	11: 74,908,719	I285T	probably damaging	Het
Stam2	T	C	2: 52,709,626	T257A	possibly damaging	Het
Suds3	A	T	5: 117,108,352	N112K	probably damaging	Het
Tedc2	T	A	17: 24,216,317	E366V	probably damaging	Het
Tedc2	C	A	17: 24,216,318	E366*	probably null	Het
Tesk2	T	C	4: 116,751,193	L104P	probably damaging	Het
Tie1	C	T	4: 118,478,963	R702H	probably benign	Het
Tpo	G	T	12: 30,119,466	A90E	probably damaging	Het
Trim30a	T	C	7: 104,411,465	D368G	probably damaging	Het
Ugt2a2	A	T	5: 87,460,579	M633K	possibly damaging	Het
Vars2	A	G	17: 35,660,061	W626R	probably damaging	Het
Vmn2r10	A	T	5: 109,006,254	Y61*	probably null	Het
Vmn2r95	T	C	17: 18,451,543	V514A	probably benign	Het
Vwa5a	T	G	9: 38,737,814		probably benign	Het
Zfp365	A	T	10: 67,909,856	C31S	probably damaging	Het
Zfp397	A	T	18: 23,960,051	I198F	possibly damaging	Het
Zfp407	C	T	18: 84,559,773	A1072T	probably benign	Het
Zfp593	T	C	4: 134,244,895	E100G	possibly damaging	Het

Other mutations in Psme4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Psme4	APN	11	30815710	critical splice donor site	probably null
IGL00401:Psme4	APN	11	30821079	splice site	probably benign
IGL00475:Psme4	APN	11	30845252	missense	probably benign	0.14
IGL00576:Psme4	APN	11	30823145	missense	possibly damaging	0.50
IGL00817:Psme4	APN	11	30820129	missense	probably benign	0.01
IGL01525:Psme4	APN	11	30809936	splice site	probably benign
IGL01862:Psme4	APN	11	30812038	nonsense	probably null
IGL02310:Psme4	APN	11	30837484	missense	probably benign	0.06
IGL02477:Psme4	APN	11	30842083	missense	probably damaging	0.99
IGL02545:Psme4	APN	11	30841586	missense	possibly damaging	0.81
IGL02608:Psme4	APN	11	30820944	missense	probably benign	0.34
IGL02621:Psme4	APN	11	30848131	missense	probably benign
IGL02822:Psme4	APN	11	30848204	unclassified	probably benign
IGL02833:Psme4	APN	11	30850715	unclassified	probably benign
IGL02964:Psme4	APN	11	30791095	nonsense	probably null
IGL03273:Psme4	APN	11	30848130	missense	probably damaging	1.00
IGL03348:Psme4	APN	11	30876796	missense	probably damaging	1.00
IGL03382:Psme4	APN	11	30807788	missense	possibly damaging	0.94
H2330:Psme4	UTSW	11	30851210	missense	probably benign	0.17
PIT4378001:Psme4	UTSW	11	30821079	splice site	probably benign
R0276:Psme4	UTSW	11	30811980	missense	probably damaging	1.00
R0462:Psme4	UTSW	11	30848117	missense	probably damaging	1.00
R0685:Psme4	UTSW	11	30878415	missense	probably damaging	1.00
R0766:Psme4	UTSW	11	30807687	splice site	probably null
R0830:Psme4	UTSW	11	30807797	missense	possibly damaging	0.53
R0940:Psme4	UTSW	11	30815264	missense	possibly damaging	0.53
R1018:Psme4	UTSW	11	30804310	missense	probably damaging	1.00
R1312:Psme4	UTSW	11	30807687	splice site	probably null
R1448:Psme4	UTSW	11	30852744	missense	probably damaging	1.00
R1713:Psme4	UTSW	11	30806310	missense	probably damaging	1.00
R1732:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R1813:Psme4	UTSW	11	30804353	missense	probably benign	0.14
R1905:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1907:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1911:Psme4	UTSW	11	30815658	missense	probably benign	0.02
R1956:Psme4	UTSW	11	30832424	missense	probably damaging	0.99
R1974:Psme4	UTSW	11	30819011	missense	probably benign	0.00
R1980:Psme4	UTSW	11	30832615	missense	possibly damaging	0.84
R2046:Psme4	UTSW	11	30817723	splice site	probably benign
R2142:Psme4	UTSW	11	30820998	missense	possibly damaging	0.89
R2698:Psme4	UTSW	11	30874282	critical splice donor site	probably null
R2844:Psme4	UTSW	11	30845173	splice site	probably benign
R3807:Psme4	UTSW	11	30856027	splice site	probably null
R3876:Psme4	UTSW	11	30856068	missense	probably damaging	0.99
R4420:Psme4	UTSW	11	30812028	missense	possibly damaging	0.67
R4584:Psme4	UTSW	11	30834318	missense	probably damaging	1.00
R4615:Psme4	UTSW	11	30834287	missense	probably benign	0.02
R4714:Psme4	UTSW	11	30832573	missense	probably benign	0.02
R5008:Psme4	UTSW	11	30856896	intron	probably benign
R5109:Psme4	UTSW	11	30791095	nonsense	probably null
R5155:Psme4	UTSW	11	30876806	missense	probably damaging	1.00
R5199:Psme4	UTSW	11	30853272	missense	probably benign	0.00
R5205:Psme4	UTSW	11	30832666	intron	probably benign
R5452:Psme4	UTSW	11	30791168	missense	probably benign
R5491:Psme4	UTSW	11	30815246	missense	possibly damaging	0.63
R5685:Psme4	UTSW	11	30809837	missense	probably damaging	0.99
R5764:Psme4	UTSW	11	30772364	intron	probably benign
R5853:Psme4	UTSW	11	30791234	critical splice donor site	probably null
R5865:Psme4	UTSW	11	30791993	missense	possibly damaging	0.95
R5903:Psme4	UTSW	11	30841589	missense	probably benign	0.28
R5927:Psme4	UTSW	11	30804294	missense	possibly damaging	0.82
R6004:Psme4	UTSW	11	30856896	intron	probably benign
R6102:Psme4	UTSW	11	30865567	missense	probably damaging	1.00
R6247:Psme4	UTSW	11	30853245	missense	possibly damaging	0.60
R6527:Psme4	UTSW	11	30832175	missense	probably benign
R6750:Psme4	UTSW	11	30853203	missense	probably damaging	1.00
R6885:Psme4	UTSW	11	30834307	nonsense	probably null
R6939:Psme4	UTSW	11	30837291	missense	probably damaging	0.99
R6945:Psme4	UTSW	11	30837437	missense	probably benign	0.06
R7029:Psme4	UTSW	11	30772474	intron	probably benign
R7049:Psme4	UTSW	11	30813904	splice site	probably null
R7098:Psme4	UTSW	11	30850661	missense	probably damaging	0.99
R7107:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R7223:Psme4	UTSW	11	30874226	missense	probably benign	0.33
R7319:Psme4	UTSW	11	30807790	missense	probably benign	0.00
R7375:Psme4	UTSW	11	30772700	splice site	probably null
R7410:Psme4	UTSW	11	30815279	nonsense	probably null
R7469:Psme4	UTSW	11	30802837	missense	probably benign	0.20
R7651:Psme4	UTSW	11	30837334	missense	probably damaging	0.98
R7679:Psme4	UTSW	11	30878425	missense	probably damaging	0.99
R7681:Psme4	UTSW	11	30791975	missense	possibly damaging	0.63
R7822:Psme4	UTSW	11	30874245	missense	probably benign
R8013:Psme4	UTSW	11	30804320	missense	probably benign	0.06
R8130:Psme4	UTSW	11	30842026	missense	probably damaging	1.00
R8323:Psme4	UTSW	11	30843532	missense	probably damaging	0.99
R8330:Psme4	UTSW	11	30843583	missense	probably benign	0.00
R8363:Psme4	UTSW	11	30812139	missense	probably damaging	1.00
R8491:Psme4	UTSW	11	30772161	missense	possibly damaging	0.90
R8690:Psme4	UTSW	11	30837319	missense	probably benign	0.00
R8696:Psme4	UTSW	11	30809896	missense	probably damaging	0.99
R8743:Psme4	UTSW	11	30878467	missense	probably damaging	1.00
R8998:Psme4	UTSW	11	30838957	missense	possibly damaging	0.78
R9241:Psme4	UTSW	11	30865576	missense	probably damaging	1.00
R9657:Psme4	UTSW	11	30838980	missense	probably benign	0.00
R9736:Psme4	UTSW	11	30847411	missense	probably damaging	0.99
R9744:Psme4	UTSW	11	30815294	critical splice donor site	probably null
R9746:Psme4	UTSW	11	30876868	nonsense	probably null
V5088:Psme4	UTSW	11	30851210	missense	probably benign	0.17
X0063:Psme4	UTSW	11	30832600	missense	possibly damaging	0.66
Z1176:Psme4	UTSW	11	30843522	missense	possibly damaging	0.87
Z1177:Psme4	UTSW	11	30806311	missense	probably damaging	1.00
Z1177:Psme4	UTSW	11	30812138	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGATACAGCAGCATTAATCTTCAGAAG -3'
(R):5'- TGGACCCAATTTCTATGATTTACTGTC -3'

Sequencing Primer
(F):5'- GACTAGAAATTTGTTACAGGGT -3'
(R):5'- TCTAGAAGCATTAGGCCAGCCTTG -3'

Posted On

2014-08-25