Incidental Mutation 'R2026:Txndc11'
ID220705
Institutional Source Beutler Lab
Gene Symbol Txndc11
Ensembl Gene ENSMUSG00000022498
Gene Namethioredoxin domain containing 11
Synonyms2810408E11Rik, EF-hand binding protein 1, Txdc11, EFP1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R2026 (G1)
Quality Score105
Status Not validated
Chromosome16
Chromosomal Location11074911-11134650 bp(-) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) CCCGCCGCCGCCGCCGC to CCCGCCGCCGCCGC at 11134474 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037633] [ENSMUST00000038424] [ENSMUST00000118362] [ENSMUST00000118679] [ENSMUST00000145225] [ENSMUST00000147884] [ENSMUST00000155221]
Predicted Effect probably benign
Transcript: ENSMUST00000037633
SMART Domains Protein: ENSMUSP00000041308
Gene: ENSMUSG00000037965

DomainStartEndE-ValueType
PDB:2DBA|A 26 157 9e-7 PDB
Blast:TPR 43 76 1e-7 BLAST
SCOP:d1ihga1 46 169 1e-11 SMART
Blast:TPR 124 156 9e-9 BLAST
low complexity region 308 319 N/A INTRINSIC
low complexity region 380 398 N/A INTRINSIC
ZnF_C2H2 443 467 1.83e2 SMART
ZnF_C3H1 630 654 1.57e1 SMART
ZnF_C3H1 770 795 8.81e0 SMART
ZnF_C2H2 856 880 1.62e0 SMART
ZnF_C3H1 902 926 1.76e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000038424
SMART Domains Protein: ENSMUSP00000041113
Gene: ENSMUSG00000022498

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 61 76 N/A INTRINSIC
low complexity region 92 103 N/A INTRINSIC
Pfam:Thioredoxin 107 208 5.8e-11 PFAM
Pfam:Thioredoxin 660 756 1e-11 PFAM
coiled coil region 793 830 N/A INTRINSIC
low complexity region 927 936 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118362
SMART Domains Protein: ENSMUSP00000113432
Gene: ENSMUSG00000022498

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 61 76 N/A INTRINSIC
low complexity region 92 103 N/A INTRINSIC
Pfam:Thioredoxin 107 208 2.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118679
SMART Domains Protein: ENSMUSP00000112601
Gene: ENSMUSG00000022498

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 61 76 N/A INTRINSIC
low complexity region 92 103 N/A INTRINSIC
Pfam:Thioredoxin 107 208 4.5e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138282
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143121
Predicted Effect probably benign
Transcript: ENSMUST00000145225
SMART Domains Protein: ENSMUSP00000116563
Gene: ENSMUSG00000022498

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 61 76 N/A INTRINSIC
low complexity region 92 103 N/A INTRINSIC
Pfam:Thioredoxin 107 208 5.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147884
SMART Domains Protein: ENSMUSP00000117426
Gene: ENSMUSG00000022498

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 61 76 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155221
SMART Domains Protein: ENSMUSP00000114777
Gene: ENSMUSG00000022498

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 61 76 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik A G 8: 120,153,466 K269R probably benign Het
Abcc12 A G 8: 86,558,233 V251A probably benign Het
Avil G A 10: 127,011,873 G556S probably damaging Het
C3 T C 17: 57,218,562 Y898C probably damaging Het
Cacng2 A G 15: 77,995,520 F201L possibly damaging Het
Casp7 T A 19: 56,436,398 I183N probably damaging Het
Cntn3 A T 6: 102,420,427 W62R probably damaging Het
Ctrb1 T C 8: 111,688,685 N119S probably benign Het
Cyp3a59 G A 5: 146,096,288 V157M probably damaging Het
Dhfr G T 13: 92,365,771 G117* probably null Het
Dido1 A T 2: 180,689,181 L158* probably null Het
Dlg2 C A 7: 91,965,723 P290Q probably damaging Het
Dnah3 T A 7: 120,039,406 Q1240L probably damaging Het
Exd1 A T 2: 119,520,305 S492T probably benign Het
Fermt1 T C 2: 132,918,525 I415M probably benign Het
Fsip2 A G 2: 82,989,444 T5174A possibly damaging Het
Fuca2 T G 10: 13,512,647 V389G probably damaging Het
Gm14412 A T 2: 177,317,105 H50Q possibly damaging Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm5129 G A 5: 29,735,734 probably benign Het
Hif3a T C 7: 17,044,397 R437G possibly damaging Het
Hook3 T C 8: 26,038,098 E588G probably damaging Het
Hs1bp3 A G 12: 8,337,738 E301G probably benign Het
Icam2 A G 11: 106,382,442 F15L probably benign Het
Ice2 T C 9: 69,416,325 S701P probably benign Het
Igf2bp1 A G 11: 95,974,170 V151A possibly damaging Het
Lig4 A T 8: 9,972,436 L448Q probably damaging Het
Man2b1 G C 8: 85,095,335 W726C probably damaging Het
Mepe T C 5: 104,327,091 S13P possibly damaging Het
Msh6 C T 17: 87,990,343 H1264Y probably damaging Het
Ncoa1 A T 12: 4,267,647 S1228R probably benign Het
Ndufa10 A G 1: 92,439,892 Y339H probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Nutm2 A G 13: 50,474,820 H640R probably benign Het
Olfr1133 G T 2: 87,645,409 A238E probably damaging Het
Olfr1487 T A 19: 13,619,581 C140S probably damaging Het
Olfr266 T C 3: 106,821,711 I283V probably benign Het
Olfr31 T C 14: 14,328,891 V260A probably benign Het
Olfr616 T A 7: 103,564,877 Y134F probably damaging Het
Olfr801 T A 10: 129,670,465 D18V probably damaging Het
Pde1c C T 6: 56,180,190 V162I probably damaging Het
Pdss2 A T 10: 43,393,875 N238I possibly damaging Het
Pfas C T 11: 68,993,957 G473E probably damaging Het
Pkn1 A G 8: 83,671,378 V795A probably damaging Het
Polq A G 16: 37,062,745 D1757G possibly damaging Het
Popdc3 T C 10: 45,314,855 W21R probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rfc1 G T 5: 65,288,029 T412K probably damaging Het
Sap130 T C 18: 31,698,574 S706P possibly damaging Het
Scgn T C 13: 23,991,064 probably benign Het
Smad7 T C 18: 75,394,154 V357A probably damaging Het
Snrnp48 G T 13: 38,209,886 A56S possibly damaging Het
Sptbn1 G T 11: 30,104,559 A2178E probably benign Het
Syn2 C T 6: 115,278,251 T508I probably benign Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmtc4 T C 14: 122,921,265 N682S probably benign Het
Trpm7 T C 2: 126,812,738 K1427E probably benign Het
Trrap A G 5: 144,803,044 I1118V possibly damaging Het
Tslp A T 18: 32,815,672 I37L probably benign Het
Ttll3 G A 6: 113,398,770 V297M probably damaging Het
Ttn T C 2: 76,710,369 D34091G possibly damaging Het
Ube3a T C 7: 59,303,726 F803L probably damaging Het
Ubn1 A G 16: 5,064,650 E325G probably damaging Het
Wfikkn2 A G 11: 94,238,953 W121R possibly damaging Het
Zfp579 C A 7: 4,993,521 E464* probably null Het
Zfp616 A T 11: 74,083,587 L227F possibly damaging Het
Other mutations in Txndc11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Txndc11 APN 16 11104632 missense probably damaging 0.96
IGL00563:Txndc11 APN 16 11104632 missense probably damaging 0.96
IGL02576:Txndc11 APN 16 11075017 unclassified probably benign
IGL03070:Txndc11 APN 16 11075287 missense probably damaging 0.97
P0047:Txndc11 UTSW 16 11091797 splice site probably benign
R0091:Txndc11 UTSW 16 11088104 missense probably benign
R0448:Txndc11 UTSW 16 11091761 missense probably damaging 0.99
R0796:Txndc11 UTSW 16 11134474 small deletion probably benign
R0960:Txndc11 UTSW 16 11091589 missense probably benign 0.28
R1184:Txndc11 UTSW 16 11128500 missense probably benign 0.03
R1327:Txndc11 UTSW 16 11116814 missense possibly damaging 0.86
R1441:Txndc11 UTSW 16 11134550 start gained probably benign
R1515:Txndc11 UTSW 16 11075062 missense probably damaging 0.98
R1699:Txndc11 UTSW 16 11087775 critical splice donor site probably null
R1709:Txndc11 UTSW 16 11128701 nonsense probably null
R1850:Txndc11 UTSW 16 11088404 missense probably damaging 0.98
R3433:Txndc11 UTSW 16 11088188 missense probably benign
R4468:Txndc11 UTSW 16 11075223 missense probably benign 0.01
R4469:Txndc11 UTSW 16 11075223 missense probably benign 0.01
R4652:Txndc11 UTSW 16 11075122 missense probably benign
R4675:Txndc11 UTSW 16 11084881 missense possibly damaging 0.65
R4697:Txndc11 UTSW 16 11084314 missense probably damaging 0.99
R4907:Txndc11 UTSW 16 11088534 missense probably benign 0.17
R5205:Txndc11 UTSW 16 11128665 missense probably damaging 0.98
R5273:Txndc11 UTSW 16 11128623 missense probably benign 0.07
R5865:Txndc11 UTSW 16 11122688 missense probably damaging 1.00
R5873:Txndc11 UTSW 16 11075205 missense probably damaging 1.00
R5941:Txndc11 UTSW 16 11075071 missense probably benign 0.04
R6360:Txndc11 UTSW 16 11084792 missense probably damaging 1.00
R6894:Txndc11 UTSW 16 11088145 missense probably damaging 1.00
R7285:Txndc11 UTSW 16 11084299 missense probably damaging 0.98
R7334:Txndc11 UTSW 16 11128561 missense probably damaging 1.00
R7502:Txndc11 UTSW 16 11087878 missense probably benign 0.08
R7660:Txndc11 UTSW 16 11087929 missense probably damaging 1.00
R7677:Txndc11 UTSW 16 11134474 small deletion probably benign
R7683:Txndc11 UTSW 16 11084235 missense probably damaging 1.00
R8315:Txndc11 UTSW 16 11075601 missense possibly damaging 0.70
X0020:Txndc11 UTSW 16 11084218 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- AGCCTCACCTGCAAGTGAAC -3'
(R):5'- AGCTTGAGTGACTGCAAGCC -3'

Sequencing Primer
(F):5'- AGTGAACTTGAGGGCGAAG -3'
(R):5'- TGCGCAGAGTCGCTACAAG -3'
Posted On2014-08-25