Incidental Mutation 'R1986:Dock4'
ID 220707
Institutional Source Beutler Lab
Gene Symbol Dock4
Ensembl Gene ENSMUSG00000035954
Gene Name dedicator of cytokinesis 4
Synonyms 6330411N01Rik, EST N28122
MMRRC Submission 039998-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.181) question?
Stock # R1986 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 40495956-40896873 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 40780062 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 621 (D621V)
Ref Sequence ENSEMBL: ENSMUSP00000152420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037488] [ENSMUST00000220912]
AlphaFold P59764
Predicted Effect probably damaging
Transcript: ENSMUST00000037488
AA Change: D621V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047387
Gene: ENSMUSG00000035954
AA Change: D621V

DomainStartEndE-ValueType
SH3 9 66 7.29e-10 SMART
Pfam:DOCK_N 69 392 8.2e-110 PFAM
Pfam:DOCK-C2 397 583 1.9e-55 PFAM
low complexity region 829 842 N/A INTRINSIC
Pfam:DHR-2 1092 1596 5e-108 PFAM
low complexity region 1651 1664 N/A INTRINSIC
low complexity region 1681 1696 N/A INTRINSIC
low complexity region 1700 1713 N/A INTRINSIC
low complexity region 1842 1872 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1940 1950 N/A INTRINSIC
low complexity region 1958 1973 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000220912
AA Change: D621V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221758
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222287
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the dedicator of cytokinesis (DOCK) family and encodes a protein with a DHR-1 (CZH-1) domain, a DHR-2 (CZH-2) domain and an SH3 domain. This membrane-associated, cytoplasmic protein functions as a guanine nucleotide exchange factor and is involved in regulation of adherens junctions between cells. Mutations in this gene have been associated with ovarian, prostate, glioma, and colorectal cancers. Alternatively spliced variants which encode different protein isoforms have been described, but only one has been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene leads to complete embryonic lethality. Heterozygotes display altered blood vessel lumen formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,212,977 (GRCm39) S105P probably damaging Het
9930111J21Rik2 T A 11: 48,910,119 (GRCm39) K771N possibly damaging Het
Abcc2 A G 19: 43,818,318 (GRCm39) E1268G probably damaging Het
Adamts4 T C 1: 171,084,244 (GRCm39) F574L possibly damaging Het
Adamts9 A G 6: 92,773,375 (GRCm39) V1165A probably benign Het
Agap2 A T 10: 126,918,913 (GRCm39) K430* probably null Het
Amn G T 12: 111,241,431 (GRCm39) G232V probably damaging Het
Ank3 A G 10: 69,703,258 (GRCm39) E297G probably damaging Het
Arhgap45 T C 10: 79,856,530 (GRCm39) L26P probably damaging Het
Atp10b C A 11: 43,063,595 (GRCm39) Q177K probably benign Het
Bbs10 A T 10: 111,135,118 (GRCm39) D77V probably damaging Het
Bltp2 A T 11: 78,165,438 (GRCm39) H1318L probably damaging Het
Bpifa1 T A 2: 153,986,256 (GRCm39) L127Q probably damaging Het
Brinp2 T C 1: 158,074,348 (GRCm39) N591S probably damaging Het
C2cd2 A C 16: 97,671,471 (GRCm39) V476G probably damaging Het
C7 T A 15: 5,041,494 (GRCm39) T471S possibly damaging Het
Cacna1b A T 2: 24,538,998 (GRCm39) Y1488N probably damaging Het
Cadps2 A G 6: 23,323,379 (GRCm39) F1001L probably damaging Het
Ccdc188 T C 16: 18,036,707 (GRCm39) S216P probably damaging Het
Ccdc24 A G 4: 117,729,213 (GRCm39) L88P probably damaging Het
Dab1 T C 4: 104,470,412 (GRCm39) I65T probably damaging Het
Drd5 A T 5: 38,477,456 (GRCm39) M150L probably damaging Het
Eef2k T A 7: 120,472,569 (GRCm39) M94K possibly damaging Het
Epg5 A G 18: 78,025,521 (GRCm39) probably null Het
Epsti1 T C 14: 78,169,673 (GRCm39) probably null Het
Ern2 T A 7: 121,770,752 (GRCm39) D754V probably benign Het
Fbxo6 A G 4: 148,230,552 (GRCm39) Y237H probably damaging Het
Fbxw24 A G 9: 109,436,124 (GRCm39) S303P probably damaging Het
Fpr-rs3 A T 17: 20,844,103 (GRCm39) probably null Het
Gab1 G T 8: 81,493,010 (GRCm39) T679K probably damaging Het
Gbp9 C A 5: 105,253,590 (GRCm39) V42F probably damaging Het
Gbp9 A T 5: 105,253,652 (GRCm39) V21E probably damaging Het
Gm20821 A G Y: 9,783,927 (GRCm39) Q183R probably benign Het
Gpatch11 A T 17: 79,151,266 (GRCm39) I226F probably benign Het
Hephl1 T G 9: 14,965,848 (GRCm39) E1035A probably damaging Het
Hspa4l T C 3: 40,714,833 (GRCm39) V156A probably damaging Het
Ifna13 A G 4: 88,562,588 (GRCm39) V12A probably benign Het
Il24 G A 1: 130,810,268 (GRCm39) T196I probably benign Het
Irgm2 A G 11: 58,110,384 (GRCm39) D37G probably benign Het
Irs1 A G 1: 82,266,486 (GRCm39) S577P probably damaging Het
Kif21b G A 1: 136,075,284 (GRCm39) D166N probably damaging Het
Krtap4-16 T C 11: 99,742,322 (GRCm39) Q26R unknown Het
Lig1 T A 7: 13,043,067 (GRCm39) Y837* probably null Het
Lrrc69 T C 4: 14,708,669 (GRCm39) E225G possibly damaging Het
Map3k20 C T 2: 72,271,638 (GRCm39) Q589* probably null Het
Masp1 T G 16: 23,302,211 (GRCm39) M347L probably benign Het
Mgat3 A T 15: 80,096,390 (GRCm39) I406F probably benign Het
Mmp1b T G 9: 7,368,577 (GRCm39) D425A probably benign Het
Mss51 T C 14: 20,533,259 (GRCm39) H404R probably benign Het
Myo15b A T 11: 115,773,701 (GRCm39) H1911L probably benign Het
Nedd4l A G 18: 65,276,874 (GRCm39) D102G probably damaging Het
Niban3 T A 8: 72,056,404 (GRCm39) I368N possibly damaging Het
Npc2 T C 12: 84,807,523 (GRCm39) K112E probably benign Het
Nuggc T A 14: 65,879,370 (GRCm39) V694E probably damaging Het
Olfm1 T G 2: 28,104,718 (GRCm39) V157G probably benign Het
Or10h28 T C 17: 33,488,489 (GRCm39) S264P probably benign Het
Or5p55 T C 7: 107,566,877 (GRCm39) V91A probably benign Het
Otogl T A 10: 107,630,051 (GRCm39) probably null Het
Ovgp1 G A 3: 105,882,251 (GRCm39) C38Y probably damaging Het
Pisd A T 5: 32,894,672 (GRCm39) S344T probably damaging Het
Psme4 T C 11: 30,780,352 (GRCm39) V840A probably benign Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Rims2 T A 15: 39,208,710 (GRCm39) M171K probably damaging Het
Rin2 T A 2: 145,720,860 (GRCm39) M731K probably damaging Het
Scgb1b19 T C 7: 32,987,108 (GRCm39) probably null Het
Serpina10 A G 12: 103,594,514 (GRCm39) I235T possibly damaging Het
Setbp1 T A 18: 78,901,759 (GRCm39) E636V probably damaging Het
Sh3d21 C T 4: 126,056,290 (GRCm39) E101K probably damaging Het
Ski T G 4: 155,306,148 (GRCm39) D225A probably damaging Het
Slc28a2b A G 2: 122,357,910 (GRCm39) T655A probably benign Het
Slc29a3 T C 10: 60,559,593 (GRCm39) Y187C probably damaging Het
Sort1 T A 3: 108,253,043 (GRCm39) D494E possibly damaging Het
Sphkap A T 1: 83,255,643 (GRCm39) L702Q probably damaging Het
Srr A G 11: 74,799,545 (GRCm39) I285T probably damaging Het
Stam2 T C 2: 52,599,638 (GRCm39) T257A possibly damaging Het
Suds3 A T 5: 117,246,417 (GRCm39) N112K probably damaging Het
Tedc2 T A 17: 24,435,291 (GRCm39) E366V probably damaging Het
Tedc2 C A 17: 24,435,292 (GRCm39) E366* probably null Het
Tesk2 T C 4: 116,608,390 (GRCm39) L104P probably damaging Het
Tie1 C T 4: 118,336,160 (GRCm39) R702H probably benign Het
Tpo G T 12: 30,169,465 (GRCm39) A90E probably damaging Het
Trim30a T C 7: 104,060,672 (GRCm39) D368G probably damaging Het
Ugt2a2 A T 5: 87,608,438 (GRCm39) M633K possibly damaging Het
Vars2 A G 17: 35,970,953 (GRCm39) W626R probably damaging Het
Vmn2r10 A T 5: 109,154,120 (GRCm39) Y61* probably null Het
Vmn2r95 T C 17: 18,671,805 (GRCm39) V514A probably benign Het
Vwa5a T G 9: 38,649,110 (GRCm39) probably benign Het
Zfp365 A T 10: 67,745,686 (GRCm39) C31S probably damaging Het
Zfp397 A T 18: 24,093,108 (GRCm39) I198F possibly damaging Het
Zfp407 C T 18: 84,577,898 (GRCm39) A1072T probably benign Het
Zfp593 T C 4: 133,972,206 (GRCm39) E100G possibly damaging Het
Other mutations in Dock4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Dock4 APN 12 40,882,305 (GRCm39) missense possibly damaging 0.48
IGL00726:Dock4 APN 12 40,840,067 (GRCm39) splice site probably benign
IGL00790:Dock4 APN 12 40,884,390 (GRCm39) missense probably damaging 1.00
IGL01061:Dock4 APN 12 40,752,968 (GRCm39) missense probably benign 0.01
IGL01083:Dock4 APN 12 40,838,380 (GRCm39) splice site probably benign
IGL01412:Dock4 APN 12 40,780,040 (GRCm39) splice site probably benign
IGL01583:Dock4 APN 12 40,860,466 (GRCm39) nonsense probably null
IGL01603:Dock4 APN 12 40,743,030 (GRCm39) missense probably damaging 1.00
IGL01766:Dock4 APN 12 40,496,378 (GRCm39) nonsense probably null
IGL02067:Dock4 APN 12 40,884,384 (GRCm39) missense probably damaging 1.00
IGL02302:Dock4 APN 12 40,775,776 (GRCm39) missense probably damaging 1.00
IGL02406:Dock4 APN 12 40,827,206 (GRCm39) missense probably benign 0.01
IGL02547:Dock4 APN 12 40,787,478 (GRCm39) missense probably benign
IGL02613:Dock4 APN 12 40,860,465 (GRCm39) missense probably damaging 1.00
IGL02643:Dock4 APN 12 40,718,429 (GRCm39) missense probably damaging 1.00
IGL02952:Dock4 APN 12 40,760,902 (GRCm39) critical splice donor site probably null
IGL02994:Dock4 APN 12 40,829,159 (GRCm39) missense probably damaging 0.99
IGL03096:Dock4 APN 12 40,798,000 (GRCm39) missense probably benign 0.00
IGL03144:Dock4 APN 12 40,742,906 (GRCm39) splice site probably benign
IGL03223:Dock4 APN 12 40,867,593 (GRCm39) missense probably damaging 1.00
IGL03296:Dock4 APN 12 40,783,256 (GRCm39) missense possibly damaging 0.84
IGL03349:Dock4 APN 12 40,783,309 (GRCm39) missense probably benign 0.42
IGL03353:Dock4 APN 12 40,867,757 (GRCm39) splice site probably null
BB005:Dock4 UTSW 12 40,838,302 (GRCm39) missense probably damaging 0.98
BB015:Dock4 UTSW 12 40,838,302 (GRCm39) missense probably damaging 0.98
R0046:Dock4 UTSW 12 40,787,359 (GRCm39) splice site probably benign
R0046:Dock4 UTSW 12 40,787,359 (GRCm39) splice site probably benign
R0110:Dock4 UTSW 12 40,671,311 (GRCm39) splice site probably benign
R0238:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0238:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0239:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0239:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0472:Dock4 UTSW 12 40,888,437 (GRCm39) intron probably benign
R0616:Dock4 UTSW 12 40,754,414 (GRCm39) missense probably benign 0.31
R0647:Dock4 UTSW 12 40,760,883 (GRCm39) missense probably damaging 1.00
R0706:Dock4 UTSW 12 40,752,922 (GRCm39) missense probably damaging 0.98
R0791:Dock4 UTSW 12 40,754,480 (GRCm39) missense probably damaging 1.00
R0940:Dock4 UTSW 12 40,681,626 (GRCm39) splice site probably benign
R1087:Dock4 UTSW 12 40,779,937 (GRCm39) missense probably benign 0.40
R1180:Dock4 UTSW 12 40,690,413 (GRCm39) missense possibly damaging 0.52
R1194:Dock4 UTSW 12 40,879,615 (GRCm39) missense probably damaging 1.00
R1463:Dock4 UTSW 12 40,866,324 (GRCm39) frame shift probably null
R1468:Dock4 UTSW 12 40,805,809 (GRCm39) missense probably benign 0.00
R1468:Dock4 UTSW 12 40,805,809 (GRCm39) missense probably benign 0.00
R1523:Dock4 UTSW 12 40,743,024 (GRCm39) missense possibly damaging 0.88
R1616:Dock4 UTSW 12 40,719,044 (GRCm39) missense probably damaging 0.99
R1682:Dock4 UTSW 12 40,775,779 (GRCm39) missense probably damaging 1.00
R1691:Dock4 UTSW 12 40,775,754 (GRCm39) missense probably benign 0.26
R1693:Dock4 UTSW 12 40,884,721 (GRCm39) missense probably benign 0.07
R1737:Dock4 UTSW 12 40,857,000 (GRCm39) splice site probably null
R1802:Dock4 UTSW 12 40,844,597 (GRCm39) missense possibly damaging 0.90
R1813:Dock4 UTSW 12 40,686,227 (GRCm39) missense probably damaging 1.00
R1846:Dock4 UTSW 12 40,783,267 (GRCm39) missense probably benign 0.00
R1959:Dock4 UTSW 12 40,760,797 (GRCm39) missense probably damaging 1.00
R1975:Dock4 UTSW 12 40,829,641 (GRCm39) splice site probably benign
R2105:Dock4 UTSW 12 40,742,988 (GRCm39) missense probably benign 0.00
R2134:Dock4 UTSW 12 40,795,667 (GRCm39) missense probably benign
R2135:Dock4 UTSW 12 40,795,667 (GRCm39) missense probably benign
R2154:Dock4 UTSW 12 40,894,547 (GRCm39) small insertion probably benign
R2154:Dock4 UTSW 12 40,870,661 (GRCm39) missense probably damaging 1.00
R2864:Dock4 UTSW 12 40,780,072 (GRCm39) missense probably damaging 1.00
R2890:Dock4 UTSW 12 40,673,800 (GRCm39) critical splice acceptor site probably null
R3086:Dock4 UTSW 12 40,781,862 (GRCm39) missense probably benign 0.02
R3808:Dock4 UTSW 12 40,722,809 (GRCm39) missense probably damaging 0.99
R3811:Dock4 UTSW 12 40,829,123 (GRCm39) missense possibly damaging 0.87
R3836:Dock4 UTSW 12 40,844,623 (GRCm39) critical splice donor site probably null
R3838:Dock4 UTSW 12 40,844,623 (GRCm39) critical splice donor site probably null
R4091:Dock4 UTSW 12 40,894,266 (GRCm39) missense probably damaging 0.99
R4735:Dock4 UTSW 12 40,681,525 (GRCm39) missense probably benign 0.31
R4752:Dock4 UTSW 12 40,496,364 (GRCm39) missense probably benign 0.04
R4828:Dock4 UTSW 12 40,718,436 (GRCm39) missense probably damaging 1.00
R5039:Dock4 UTSW 12 40,867,745 (GRCm39) missense probably damaging 1.00
R5092:Dock4 UTSW 12 40,894,440 (GRCm39) missense probably benign
R5146:Dock4 UTSW 12 40,699,491 (GRCm39) splice site probably null
R5213:Dock4 UTSW 12 40,726,741 (GRCm39) missense probably damaging 1.00
R5214:Dock4 UTSW 12 40,754,465 (GRCm39) missense probably benign 0.00
R5270:Dock4 UTSW 12 40,783,270 (GRCm39) missense probably benign 0.02
R5426:Dock4 UTSW 12 40,795,744 (GRCm39) missense probably damaging 1.00
R5474:Dock4 UTSW 12 40,795,730 (GRCm39) missense probably benign
R5544:Dock4 UTSW 12 40,884,701 (GRCm39) missense possibly damaging 0.87
R5615:Dock4 UTSW 12 40,699,479 (GRCm39) missense probably benign 0.22
R5649:Dock4 UTSW 12 40,894,539 (GRCm39) missense probably benign 0.03
R5702:Dock4 UTSW 12 40,787,490 (GRCm39) missense probably benign 0.02
R5846:Dock4 UTSW 12 40,867,735 (GRCm39) missense probably damaging 1.00
R5847:Dock4 UTSW 12 40,671,250 (GRCm39) missense probably damaging 0.97
R5895:Dock4 UTSW 12 40,805,812 (GRCm39) missense probably damaging 1.00
R5997:Dock4 UTSW 12 40,805,833 (GRCm39) missense probably damaging 0.99
R6011:Dock4 UTSW 12 40,867,756 (GRCm39) critical splice donor site probably null
R6022:Dock4 UTSW 12 40,798,109 (GRCm39) missense probably benign 0.04
R6038:Dock4 UTSW 12 40,783,350 (GRCm39) splice site probably null
R6038:Dock4 UTSW 12 40,783,350 (GRCm39) splice site probably null
R6179:Dock4 UTSW 12 40,781,868 (GRCm39) missense probably benign 0.00
R6479:Dock4 UTSW 12 40,878,954 (GRCm39) missense probably damaging 1.00
R6516:Dock4 UTSW 12 40,781,898 (GRCm39) missense possibly damaging 0.94
R6748:Dock4 UTSW 12 40,754,465 (GRCm39) missense probably benign 0.44
R6752:Dock4 UTSW 12 40,870,616 (GRCm39) missense probably damaging 1.00
R6814:Dock4 UTSW 12 40,862,325 (GRCm39) critical splice donor site probably null
R6864:Dock4 UTSW 12 40,795,745 (GRCm39) missense probably damaging 1.00
R6872:Dock4 UTSW 12 40,862,325 (GRCm39) critical splice donor site probably null
R6891:Dock4 UTSW 12 40,829,135 (GRCm39) missense probably damaging 1.00
R6937:Dock4 UTSW 12 40,884,634 (GRCm39) missense probably benign 0.01
R6950:Dock4 UTSW 12 40,783,313 (GRCm39) missense possibly damaging 0.80
R7081:Dock4 UTSW 12 40,671,285 (GRCm39) missense probably damaging 1.00
R7129:Dock4 UTSW 12 40,878,878 (GRCm39) missense probably damaging 1.00
R7140:Dock4 UTSW 12 40,686,158 (GRCm39) missense probably benign 0.06
R7241:Dock4 UTSW 12 40,844,859 (GRCm39) missense probably damaging 1.00
R7378:Dock4 UTSW 12 40,838,243 (GRCm39) missense possibly damaging 0.94
R7714:Dock4 UTSW 12 40,775,648 (GRCm39) nonsense probably null
R7720:Dock4 UTSW 12 40,856,974 (GRCm39) missense probably damaging 0.99
R7756:Dock4 UTSW 12 40,760,878 (GRCm39) missense probably benign 0.02
R7758:Dock4 UTSW 12 40,760,878 (GRCm39) missense probably benign 0.02
R7759:Dock4 UTSW 12 40,867,735 (GRCm39) missense probably damaging 1.00
R7787:Dock4 UTSW 12 40,775,676 (GRCm39) missense probably benign
R7879:Dock4 UTSW 12 40,780,083 (GRCm39) missense possibly damaging 0.76
R7928:Dock4 UTSW 12 40,838,302 (GRCm39) missense probably damaging 0.98
R8000:Dock4 UTSW 12 40,883,118 (GRCm39) missense probably benign 0.05
R8042:Dock4 UTSW 12 40,795,759 (GRCm39) missense probably benign 0.01
R8231:Dock4 UTSW 12 40,752,950 (GRCm39) missense possibly damaging 0.88
R8234:Dock4 UTSW 12 40,884,837 (GRCm39) splice site probably null
R8758:Dock4 UTSW 12 40,838,231 (GRCm39) missense probably benign 0.12
R8871:Dock4 UTSW 12 40,795,730 (GRCm39) missense probably benign
R8873:Dock4 UTSW 12 40,726,767 (GRCm39) nonsense probably null
R8884:Dock4 UTSW 12 40,856,884 (GRCm39) missense probably damaging 1.00
R9164:Dock4 UTSW 12 40,754,337 (GRCm39) missense probably damaging 1.00
R9225:Dock4 UTSW 12 40,879,669 (GRCm39) missense probably benign 0.02
R9276:Dock4 UTSW 12 40,699,404 (GRCm39) missense possibly damaging 0.48
R9307:Dock4 UTSW 12 40,686,155 (GRCm39) missense probably damaging 1.00
R9675:Dock4 UTSW 12 40,894,393 (GRCm39) small insertion probably benign
R9675:Dock4 UTSW 12 40,894,379 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,397 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,387 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,379 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,401 (GRCm39) small insertion probably benign
R9678:Dock4 UTSW 12 40,894,396 (GRCm39) small insertion probably benign
R9678:Dock4 UTSW 12 40,894,387 (GRCm39) small insertion probably benign
R9678:Dock4 UTSW 12 40,894,379 (GRCm39) small insertion probably benign
R9691:Dock4 UTSW 12 40,686,097 (GRCm39) missense probably damaging 1.00
RF018:Dock4 UTSW 12 40,894,398 (GRCm39) frame shift probably null
RF025:Dock4 UTSW 12 40,894,392 (GRCm39) frame shift probably null
RF063:Dock4 UTSW 12 40,894,398 (GRCm39) frame shift probably null
X0028:Dock4 UTSW 12 40,719,046 (GRCm39) missense probably benign 0.25
Z1176:Dock4 UTSW 12 40,681,615 (GRCm39) missense probably benign 0.16
Z1176:Dock4 UTSW 12 40,681,613 (GRCm39) missense probably benign 0.01
Z1177:Dock4 UTSW 12 40,867,640 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GCTTGATCTTTTGAAATGGAGAACCC -3'
(R):5'- GTGTTACAGAACCCAGTGCC -3'

Sequencing Primer
(F):5'- ACCCAGACAAGATCACAGGCTG -3'
(R):5'- AGAACCCAGTGCCAATCTTTTC -3'
Posted On 2014-08-25